1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serg [7]
3 years ago
12

Through which tissue do sugars get transported to reach the leaves during growth and reproduction

Biology
1 answer:
jekas [21]3 years ago
8 0
The answer is the Phloem. Food=Phloem
You might be interested in
What is cytokinesis​
Tresset [83]
Cytokinesis is a part of cell division, both Meiotic cell division and Mitotic cell division, when a parent cell is divided into two daughter cells and each daughter cell receives 50% of the cytoplasm, 50% of the organelles, and an exact copy of the parental DNA (in mitosis)
7 0
3 years ago
Name two ways that atoms can combine to become more stable in compounds
creativ13 [48]

Answer:wo processes by which elements can combine to form stable compounds are transferring electrons from one atom to another (ionic compounds) or by sharing electrons (covalent compounds).

Explanation:

i had that question before:)

6 0
3 years ago
Read 2 more answers
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
2 years ago
B) Explain how the human version of Ced-9 protein is related to the human apoptosis pathway?
Katyanochek1 [597]

Answer: Cell death abnormality gene 9 (CED-9) is found in Caenorhabditis  elegans inhibits/represses programmed cell death (apoptosis) also known as apoptosis regulatorCED-9

Explanation:

5 0
3 years ago
How does the electromagnetic spectrum relate to a grouping of stars based on color?
Svetlanka [38]

Explanation:

Objects in the universe send out an enormous range of electromagnetic radiation. Scientists call this range the electromagnetic spectrum, which they have divided into a number of categories

i hope it would help

please mark me as a brainliest

6 0
3 years ago
Read 2 more answers
Other questions:
  • Jupiter is 317 times more massive than the Earth. Its gravitational attraction is _____ Earth's.
    11·2 answers
  • Which microscope would be most useful for quickly estimating the number of red blood cells in a patients blood sample
    7·2 answers
  • What system includes the living components of the Earth?
    5·2 answers
  • Each of the following is a main idea of the cell theory except
    9·1 answer
  • Atoms of the same element that differ in the number of neutrons they contain are called
    6·1 answer
  • 4. What are some of the things scientists might do to analyze data?
    7·2 answers
  • Our bodies are made up of the same types of organic compounds as all other living organisms. Complete the following sentences by
    10·1 answer
  • What is the simplest life form
    12·1 answer
  • What is a model?
    6·2 answers
  • Meaning of <br> biology and living things
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!