1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
3 years ago
8

If China has a population of 1,355,935,022 people and an area of 3,705,405 mi2 what is the population density of China? a. 77 pe

ople/mi2 b. 123 people/mi2 c. 0.00273 people/mi2 d. 366 people/mi2
Biology
1 answer:
marin [14]3 years ago
7 0
C is the right answer

You might be interested in
Which one, wave b, wave c, or wave d
pochemuha

Answer:

Wave C (tell me if I'm right or wrong)

Explanation:

7 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Does compounds keep or lose their original properties?
Salsk061 [2.6K]
Compounds Lose their original properties

5 0
4 years ago
Read 2 more answers
With the exception of the 12 cranial nerves, other major nerves exit the brain through the:
Oksana_A [137]
I think the answer should be medulla oblongata or foramen magnum.

The major nerves that leave brain should form a thick cord in the brain stem that called medulla oblongata. Medulla oblongata will pass a big hole in the base of the skull that called foramen magnum. Depends on what part the question asked(bone or tissue), it probably between those two options.
3 0
3 years ago
Which of the following would change the allele frequencies of a
Readme [11.4K]
C is the correct answer
4 0
3 years ago
Read 2 more answers
Other questions:
  • The process by which two species, for example, a flower and a pollinating insect, evolve in response to each other is called ___
    6·1 answer
  • Plants and animals die without air. Why? Which gases do plants and animals inhale and exhale? What are the role of these gases i
    8·1 answer
  • The composition of a sedimentary rock depends upon the composition of the rocks and living things its sediments came from.
    8·2 answers
  • How is energy released in organic compounds?
    15·2 answers
  • For APEX A mitochondrion cannot produce new molecules. Which structure is most
    9·2 answers
  • What are the first three steps of scientific inquiry are related.
    9·1 answer
  • What do you think happens to the particles of air inside the ball as it warms in the sun?
    5·1 answer
  • What is the most significant contributor to sea level rise?
    14·1 answer
  • Why are graphs useful when interpreting data? They make trends in the data easier to see. O They are easier to create than data
    7·1 answer
  • PLEASE HELPPPP
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!