1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wittaler [7]
3 years ago
14

In the desert food web shown below, which of the following best describes the transfer of energy between cacti and mule deer?

Biology
1 answer:
fgiga [73]3 years ago
7 0
The correct option is B.
In the ecosystem, energy flows from one trophic level to the other. The first trophic level is that of the producers which use the energy of the sun to produce their own food. Out of the energy obtained from the sun by the producers only about 3% of it is converted into food products. The second trophic level is made up of the herbivores and the omnivores which eat the plant. Only about 10% of the energy from the plant is transferred to the animals in the second trophic level. These second trophic level animals will also transfer about 10% of the energy they obtain to the animals in the third trophic level when they are eaten. Thus, it can be seen that the energy that is transferred in the ecosystem is gradually reducing from one trophic level to another.
You might be interested in
Give several reasons why five trained individuals might come up with different readings
andriy [413]

Various reasons why five trained individuals might come up with different readings are - while carrying out an experiment, the accuracy with which each individual perform an experiment varies. The readings in different instruments used while performing an experiment also differs.

There is certain percentage of error that occurs while carrying out an experiment by each of the individual. Physical conditions such as temperature, pressure changes from one place to another where the experiments are being carried out.

5 0
3 years ago
A potential source of confusion in constructing a phylogeny tree is similarity between organisms that is due to:.
jok3333 [9.3K]

 convergent evolution - called analogy

a potential source of confusion in constructing a phylogeny is similarity between organisms that is due to convergent evolution - called analogy - rather than to shared ancestry. thus for mammals, the backbone is a shared ancestral character, a character that originated in an ancestor of the taxon

6 0
3 years ago
How do I harness the power of my brain?
frozen [14]
U think smth duh!!!!!!!!
7 0
3 years ago
What is the idea of devotion and loyalty to a country called that Africans
andriy [413]
I think its A- independence
6 0
3 years ago
The steroid hormone secreted by the adrenal cortex, which stimulates salt reabsorption in the kidneys is ________.
Nuetrik [128]

Answer:

<h2>Aldosterone</h2>

Explanation:

Hope I helped.

6 0
3 years ago
Other questions:
  • Acceleration due to gravity is also called
    13·2 answers
  • Why do the cells in all living things need energy?
    13·1 answer
  • (05.02 LC)<br> Which of the following is one stage of the cell cycle?
    5·1 answer
  • What happens if the body is unable to maintain glucose levels
    15·1 answer
  • Discuss the distribution of earthquakes and volcanoes over the surface of the earth. Are they scattered at random or are they co
    9·1 answer
  • Directions: Read and understand each question very well. Write the letter on a separate sheet of paper. 1. Which of these explai
    14·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which of the following is true of malignant tumors?
    6·2 answers
  • Explain how a father with brown eyes and a mother with blue eyes can have children
    6·1 answer
  • Particulates can:_____.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!