1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ronch [10]
4 years ago
15

Of rocky planet which has no atmosphere at all

Biology
2 answers:
kkurt [141]4 years ago
6 0
Of the planets Mercury has a thin atmosphere which causes it to change from burning and freezing temperatures. Hope this helps. <span />
In-s [12.5K]4 years ago
4 0
Mercury because it is way too hot to have an atmosphere.

You might be interested in
A researcher is trying to design an experiment to measure the amount of energy a person uses during different activities. He pro
Tomtit [17]

The right answer is to measure the amount of released carbon dioxide.

The carbon dioxide exhaled by the lungs can reflect the energy consumed by the body since it comes from the degradation of glucose which is the main energy substrate. And this is a better indicator of energy consumption than measuring heart rate because it can be inflected by several factors.


A is false because glucose is not found in the urine, except in the case of diabetes mellitus.

C is false because the consumption of calories does not mean that we will directly use it.

D is wrong because perspiration is independent of energy consumption, this is a way to cool the body after exercise.

7 0
3 years ago
Read 2 more answers
Female mosquito is considered more harmful than male mosquito. give reason
Scrat [10]

Answer:

The female mosquitoes are the dangerous ones. They bite and draw blood. Male mosquitoes feed on flower nectar. Males have very hairy and fuzzy antennae (like a powder puff) whereas females have less hairy antennae.

3 0
3 years ago
Read 2 more answers
what are homologous and vestigial structures and how do they support the theory of evolution by natural selection
sweet-ann [11.9K]

Answer:

Summary. Multiple types of evidence support the theory of evolution: Homologous structures provide evidence for common ancestry, while analogous structures show that similar selective pressures can produce similar adaptations (beneficial features).

Explanation:

Brainliest is appreciated, have a nice day :)

6 0
3 years ago
Compare and contrast the effects of inavasive species, speciation and extinction biodiversity
andreyandreev [35.5K]

Answer:

Modern invasive species are characterized by broad environmental tolerances, which contribute to their ability to survive during both the transport and establishment phases of invasion. Studies of modern and invasive species have demonstrated that invader species regularly displace native species through higher resource efficiency or competitive ability. A striking feature of the biogeographic pattern is the differential survival of species with large geographic ranges. Species with larger geographic ranges tend, on average, to have broader ecological tolerances than those with small ranges.

Explanation:

5 0
3 years ago
Which example shows an organism maintaining homeostasis?
Naddik [55]
The example that shows an organism maintaining homeostasis is b. a person sweating on a hot day. Homeostasis is an organism's ability to maintain a stable internal environment irrespective of the external environment. When a person's body overheats, the body releases water as perspiration or sweat to cool itself down. Another example is when a person gets cold, the hair on his arms and legs, stand up straight - to trap air circulating round his body, and heat it up. 
6 0
3 years ago
Other questions:
  • The nutrients that provide the greatest amount of energy per gram are _____
    11·1 answer
  • Which aspect of the angiosperm life cycle and morphology, depicted above, is not unique to angiosperms?
    10·1 answer
  • What is the definition of mecrator map projection
    12·1 answer
  • An important component of the lamina propria in the upper respiratory system is
    12·2 answers
  • In which environment would you find dolphins
    10·1 answer
  • When should you figure out what the constraints and criteria are?
    10·2 answers
  • Describe what would happen to the consumers and producers within the ecosystem if the bacteria were wiped out or removed?
    8·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Will give brainliest<br> What is this?
    8·2 answers
  • Present at the centre of root and used in transportation of materials
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!