1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Effectus [21]
2 years ago
5

Which compound that provides energy in cells is made in every tube where cellular respiration is occuring?

Biology
1 answer:
sergeinik [125]2 years ago
7 0

Answer:

ATP

Explanation:

Adenosine triphosphate, commonly known as ATP, is the chemical molecule that stores and provides/releases energy in cells. ATP is needed by the cells of every living organism and is obtained via a process called CELLULAR RESPIRATION.

Cellular respiration is the process whereby cells breakdown food molecules (sugar) to synthesize energy storing molecules called ATP. Hence, in every tube where cellular respiration is occuring, ATP is the produced molecule that provides energy.

You might be interested in
Why do animals become adapted to their environments?
marin [14]

Answer:

For survival

Explanation:

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators, and other species that compete for the same food and space.

Hope this helps:)

3 0
2 years ago
There are many routes of administration that can deliver drugs directly to the developing fetus. The direct fetal routes of drug
rjkz [21]

Answer:

The correct answer is option - 1. If passage through the placenta is adversely affected by fetal disease. and 4. If rapid drug effects are required.

Explanation:

Normally the drug that is provided and administrated to the fetal is through the placenta of the mother. The direct delivery of medicine can be dangerous. However, with the advancement of the medical technology direct fetal drug administration is possible and it assists in the rapid uptake of the drug by the fetus.

If the fetus requires a rapid drug effect it can be provided by direct drug delivery. Also when the placental is not working properly and affected by the disease it is recommended to provide the fetus with the drug with the help of direct delivery.

Thus, the correct answer is : 1. If passage through the placenta is adversely affected by fetal disease. and 4. If rapid drug effects are required.

3 0
3 years ago
The process of making an exact copy of dna is called
lubasha [3.4K]

Answer:

Replication

Explanation:

5 0
2 years ago
Read 2 more answers
Guys hurry what is genotype and what is phenotype
Gnoma [55]

Answer: Phenotype= the set of observable characteristics of an individual resulting from the interaction of its genotype with the environment.

Genotype= In a broad sense, the term "genotype" refers to the genetic makeup of an organism; in other words, it describes an organism's complete set of genes.  Humans are diploid organisms, which means that they have two alleles at each genetic position, or locus, with one allele inherited from each parent.

Explanation:

Please add me as brainlist

8 0
3 years ago
The flowering part in monocot plants are in multiples of threes.<br><br> TRUE<br><br> FALSE
Rudik [331]
The flowering part in Monocot plants are in multiples of threes is a true statement. There can be either three or in multiples of three <span>flowering parts. </span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • "Which of the following fish should be avoided because of high mercury content"? a. sardines b. cod and sole c. most shellfish d
    15·1 answer
  • Which of the following are the three kinds of RNA? A. rRNA, dRNA, mRNA B. rRNA, mRNA, tRNA C. iRNA, mRNA, sRNA D. tRNA, dRNA, rR
    14·2 answers
  • The flux that removes the majority of excess calcium from the ocean is:
    5·1 answer
  • Ethology is the study of how animals behave towards each other and in response to
    6·2 answers
  • The following would be a cognitive symptom of schizophrenia.
    7·2 answers
  • How do fossils of extinct species provide evidence of how life on earth has changed?
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What does it mean for a trait to be dominant?
    6·2 answers
  • Active transport is different from simple diffusion because active transport
    15·1 answer
  • TRUE/FALSE. establishing a family history of osteoarthritis, rheumatoid arthritis, or ankylosing spondylitis is important becaus
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!