Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Transcription and RNA processing (splicing)
Explanation:
Although Howard is almost right, the DNA sequence does not precisely relate to the protein sequence. First of all, the DNA is transcribed to an primary mRNA molecule. Bur before the mRNA is ready to be translated into an amino acid sequence, it must be processed into a mature mRNA.
This includes adding a 3' poly A tail, and a 5' cap, and importantly for this question, splicing.
Splicing is the removal of non protein coding intermediate sequences called introns from the protein coding regions (exons) of a primary mRNA. This means that lots of the DNA sequence is not dictated by the final protein, as many of the intervening sequences have been removed by splicing.
Answer:
Dacitic magma is formed by the subduction of young oceanic crust under a thick felsic continental plate. Oceanic crust is hydrothermally altered causing addition of quartz and sodium.
Answer:
lytic
Explanation:
The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell
For the first question, it's D. And the second question it's C.
