1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leokris [45]
3 years ago
8

Small children have a tendency not to eat a variety of foods, which can harm them in early development. A mother brings her daug

hter to the pediatrician with the concern that her daughter will only eat French fries. What macromolecule might her daughter be deficient in and how would it affect her?
Biology
1 answer:
TEA [102]3 years ago
5 0

Answer:

Option C: Proteins, the daughter would have stunted growth due to the inability to produce new tissue and muscles.

Explanation:

Proteins are the building blocks of the body and it is a necessity to carry out normal metabolism and cell sign.

You might be interested in
Which method of heat transfer is due to the transfer of kinetic energy from one molecule to another?
Akimi4 [234]
It would be convection because it isnt having any physical collision which rules out conduction and it is going through mid air which rules out evaporation and radiation
3 0
3 years ago
Read 2 more answers
How tendonitis affect homeostasis? Include body systems that are affected?
Artist 52 [7]
Tendonitis affects homeostasis by posing a huge health problem such as Mechanical stress.
6 0
3 years ago
Jumble letter can you help me plsss​
sveticcg [70]
<h2>Answer</h2>

  1. Wind
  2. Sunlight
  3. Plants
  4. Soil
  5. Coal
  6. Minerals
  7. Water
  8. Animals

\\

In short it's natural resources.

3 0
3 years ago
Cual hormona de la pituitaría estimula la producción de testosterona?
Lostsunrise [7]

Explanation:

Cuando los niveles de testosterona están bajos, la hormona liberadora de gonadotrofina (GnRH) es liberada por el hipotálamo que a su vez estimula la glándula pituitaria para liberar LH. Esta última hormona estimula los testículos para sintetizar la testosterona.

3 0
3 years ago
Read 2 more answers
Why did only about one fourth of mendel's f2 plants exhibit the recessive trait
ahrayia [7]
According to the punnet square, if you combine a parental homogeneous dominant trait and a heterogeneous trait. 1 out of the 4 boxes will be homogeneously recessive.
7 0
3 years ago
Other questions:
  • A baby elephant has a mass of 100,000 g. How many kilograms does the baby elephant weigh?
    14·1 answer
  • "I wanted the ideal animal to hunt," explained the general. "So I said, ‘What are the attributes of an ideal quarry?' And the an
    10·2 answers
  • What's the different metaphase 1 of mesious and metaphase of mitosis?
    5·1 answer
  • Lisa enters her high school chemistry class wearing a big fuzzy Christmas sweater with long, baggy sleeves. Her teacher, Mrs. Dr
    8·2 answers
  • Which of the following is living organism
    13·1 answer
  • Name 3 sources of CO2.
    11·1 answer
  • Which of the following is NOT a characteristic of protozoans
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which process occurs when liquid water becomes water vapor
    6·1 answer
  • The electrical current that travels down the axon of a neuron is known as what?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!