1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
2 years ago
14

Question 7

Biology
1 answer:
Akimi4 [234]2 years ago
5 0

Answer:

Its D. I hope this helps!

You might be interested in
What information can you get about earthquakes location from only two seismic stations data?
maksim [4K]

<u>Answer</u>:

From only two seismic stations data we can get the direction from which the Earthquake originated.

<u>Explanation</u>:

When the information taken into consideration from only one station, it tells us about the epicenter of the earthquake could at any point on that circle. when the information comes from two stations, the circles intersect at  2  points, so there are possibility  of having two epicenters. With three stations, the circles intercept at only one point, which must be the epicenter. The sesmic station present in the network helps in measuring the movement of plates from the ground motion. the signature sesmograph tells us about the bigger earthquakes.

8 0
3 years ago
The appropriate unit for defining and measuring genetic variation is the
aksik [14]
Population........................................................................

6 0
3 years ago
Abnormal softening of a gland is known as
Greeley [361]
Abnormal softening of a gland is known as the adenomalacia.
8 0
3 years ago
Identify the chloroplast. A structure of a plant cell. Letters from A to E indicate definite structures. Letter A indicates a gr
uysha [10]

Answer:

Letter A

Explanation:

From the description you make, it's likely that the structure with letter A is the chloroplast. It is round and small and it's free because of the pigment needed for photosynthesis (chlorophyll). It is located inside the cell, suspended in the cytoplasm.

6 0
3 years ago
With respect to life expectancy, because ________ are at higher risk for disease and early death, they reap somewhat larger gene
Nataly_w [17]

Answer:

The correct answer to fill in the blank is: D) men.

Explanation:

According to different studies made over the years, it has been revealed that men have a lower life expectancy (76 years) than women (81 years), Japanese Americans (87 years) and individuals of middle socioeconomic status.

Since men are the group with the higher risk, they can benefit more from changes in their lifestyle like exercising and having healthy diets.

6 0
3 years ago
Other questions:
  • Which food must be cooked to a minimum internal temperature of 155 f. for at least 15 seconds?
    11·1 answer
  • the intake of food must be monitored to make sure that the cells in the body possess the essential nutrients to function​
    15·1 answer
  • How are the monsoons both beneficial and destructive?
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why do we use arrows when creating a food web? What do they represent?
    14·1 answer
  • How do we get more energy from the sun?
    7·2 answers
  • Cellular respiration (fill in the blank)
    10·2 answers
  • What is science DO NOT COPY AND PASTE!!!
    13·2 answers
  • ᴡʜᴀᴛ ɪꜱ ᴄʜᴀʀᴄᴏʟ ?? <br>ᴅᴇꜰɪɴᴇ ɪᴛ ​
    5·2 answers
  • 9. Which three organisms in the food web are competing for the<br> same food resource?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!