1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delicious77 [7]
2 years ago
9

How many pairs of chromosomes are in found in the average human?

Biology
1 answer:
Natali5045456 [20]2 years ago
6 0
We have Twenty-three :)
You might be interested in
The ____________ in the alveoli is 40 mm Hg and that of the blood entering the pulmonary capillaries is ____________ . This caus
Oxana [17]

Answer:

The <u>PCO₂</u> -carbon dioxide partial pressure- in the alveoli is 40 mm Hg and that of the blood entering the pulmonary capillaries is <u>45 mmHg</u>. This causes <u>carbon dioxide</u> to diffuse down its partial pressure gradient from the blood into the alveoli.

Explanation:

Gas exchange is a physiological process that involves the entry of oxygen into the body and tissues and the exit of carbon dioxide, a product of metabolic reactions.

At the pulmonary level, gas exchange occurs between the alveoli and the alveolar capillary, and the diffusion of gases across the alveolar-capillary barrier is dependent on a pressure gradient due to the partial pressure of gases.

In the case of CO₂ the diffusion goes from where the partial pressure is higher to where it is lower, i.e. <u>from the alveolar capillary, where the PCO₂ is 45 mmHg, to the pulmonary alveolus, where the PCO₂ is 40 mmHg</u>.

Learn more:

Gas exchange brainly.com/question/4469204

6 0
3 years ago
The image illustrates a human-induced environmental change.
Troyanec [42]

Answer:

Wildlife Hazard

Explanation:

Wildlife in dangerous place

3 0
2 years ago
PLEASE HELP! what are environmental parameters that should be examined before building on land?
Serhud [2]
I would say that you would need to see what the environment around the area is. and what kinds of animals would be out of homes.<span />
5 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Research on obesity and weight control indicates that
shepuryov [24]
The answer is letter d, it is because when a person becomes obese, he or she is likely to intake small amounts of food if he or she wants to maintain his or her weight and if the person does not want to gain weight anymore and than it is more different when gaining weight or when the person was in the point to become obese because he or she has ingested more food to gain weight.
8 0
2 years ago
Other questions:
  • What are covalent bonds???
    14·2 answers
  • What happens in the alveoli in the process of gas exchange
    10·1 answer
  • How is the reaction described where energy is absorbed because of a chemical reaction?
    14·1 answer
  • How might a dramatic decrease in vegetation lead to a decrease in a prey species?
    9·1 answer
  • The tongue is covered with hairlike projections called
    6·1 answer
  • Why were the firstcells probaly anerorcbic?
    6·2 answers
  • A student sees a bee on a flower. The student wonders how the bee finds flowers. This student is displaying the scientific attit
    14·2 answers
  • TRUE OR FALSE: Heritability is important for both natural and artificial
    6·1 answer
  • How is each cell like a big city?
    8·1 answer
  • 2. A woman has just given birth to a daughter with a birth defect; malformation of her outer wear. The mother’s labs also indica
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!