Answer:
The <u>PCO₂</u> -carbon dioxide partial pressure- in the alveoli is 40 mm Hg and that of the blood entering the pulmonary capillaries is <u>45 mmHg</u>. This causes <u>carbon dioxide</u> to diffuse down its partial pressure gradient from the blood into the alveoli.
Explanation:
Gas exchange is a physiological process that involves the entry of oxygen into the body and tissues and the exit of carbon dioxide, a product of metabolic reactions.
At the pulmonary level, gas exchange occurs between the alveoli and the alveolar capillary, and the diffusion of gases across the alveolar-capillary barrier is dependent on a pressure gradient due to the partial pressure of gases.
In the case of CO₂ the diffusion goes from where the partial pressure is higher to where it is lower, i.e. <u>from the alveolar capillary, where the PCO₂ is 45 mmHg, to the pulmonary alveolus, where the PCO₂ is 40 mmHg</u>.
Learn more:
Gas exchange brainly.com/question/4469204
Answer:
Wildlife Hazard
Explanation:
Wildlife in dangerous place
I would say that you would need to see what the environment around the area is. and what kinds of animals would be out of homes.<span />
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The answer is letter d, it is because when a person becomes obese, he or she is likely to intake small amounts of food if he or she wants to maintain his or her weight and if the person does not want to gain weight anymore and than it is more different when gaining weight or when the person was in the point to become obese because he or she has ingested more food to gain weight.