1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler [38]
3 years ago
7

PlSSS HELPP IM TIMED!!

Biology
1 answer:
podryga [215]3 years ago
6 0

Answer:

B

Explanation:

You might be interested in
Describe a feedback loop?
satela [25.4K]

Answer:

A feedback loop is a biological occurrence where the output of a system amplifies the system (positive feedback) or inhibits the system (negative feedback).

Explanation:

Example, during blood clotting, a cascade of enzymic proteins acitvates each other, leading to the formation of fibrin clot that prevents further blood loss.

6 0
2 years ago
Gemmules are packets of sperm used by plants for sexual reproduction
denpristay [2]
I believe it is true A
5 0
3 years ago
Read 2 more answers
What can cause rapid revolution?
Yuki888 [10]

Answer:

Although scholarly debate continues about the exact causes of the Revolution, the following reasons are commonly adduced: (1) the bourgeoisie resented its exclusion from political power and positions of honour; (2) the peasants were acutely aware of their situation and were less and less willing to support.

Explanation:

brainliest?

7 0
2 years ago
Which of the following categories contains the most species?
bulgar [2K]
Phylum, it is the second largest group.
6 0
2 years ago
Read 2 more answers
Which biomolecule has CHO and can be found in a ring form?
Arisa [49]
The answer is carbohydrate.
5 0
3 years ago
Other questions:
  • A patient presents with low copper. which portion of cellular respiration would suffer?
    7·1 answer
  • The sphere that consists of soil, sand, rocks and all structures comprising the land is the
    11·1 answer
  • Why don't we experience a solar eclipse every month?
    5·1 answer
  • The diagram shows molecules moving across a selectively permeable membrane. The smaller circles represent salt molecules, and th
    12·2 answers
  • What sex chromosomes does a daughter inherit from her father
    8·1 answer
  • which of the following terms does not refer to the shape of a bacterium? a. tetanus b. bacillus c. spirillum d. coccus
    7·1 answer
  • 6. The two largest (by percent) sources of electricity in this state are: (Choose two)
    7·1 answer
  • List three products of respiration ..
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Characteristics of life living things worksheet biology 
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!