1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
8

I will give Brainliest!!! Make a chart (and upload it here) showing how each propagation method is done. List 2 good things and

1 bad thing about each type. Tell whether each propagation type is sexual or asexual. Include a picture of the propagation method and one example of a commonly used plant for that method.
Seeds
Cuttings (stem, leaf, and root)
Layering (5 types – simple, tip, trench, mound, and air)
Division/Separation
Grafting/Budding (whip graft, cleft graft, and T-bud)
Tissue Culture
Biology
1 answer:
Citrus2011 [14]3 years ago
8 0

Answer:

we have to make chart and send it to you

You might be interested in
What are the two cells that pick up light and color in the back of your eye
Luden [163]

Answer:

The retina is the back part of the eye that contains the cells that respond to light. These specialized cells are called photoreceptors. There are 2 types of photoreceptors in the retina: rods and cones.

Explanation:

4 0
4 years ago
Read 2 more answers
An Emergency Medical Responder reports that a male​ patient, injured while playing​ football, has bruising to the lumbar area of
Eduardwww [97]

Answer:

C) Lower back

Explanation:

The lumbar area is located between the chest, the spine and the sacrum. This area corresponds to the lower back and has five vertebrae: L1-L5. According to this, the  answer is that based on this​ statement, the EMT should expect to find bruising in the lower back.

4 0
3 years ago
Which of these describes a difference between viruses and cells?
Lerok [7]

Answer: Cells contain protein, and viruses contain only carbohydrates. Cells reproduce independently, and viruses require a host to reproduce.

Explanation:

5 0
3 years ago
The blood type AB is an example of complete or incomplete dominance.
Drupady [299]
Your alleles of your blood cellw
8 0
4 years ago
Read 2 more answers
Why do cells go through the cell cycle
pentagon [3]

Answer:

The most basic function of the cell cycle is to accurately copy a large amount of DNA in the chromosomes and then precisely separate the copies into two genetically identical daughter cells.

Explanation:

6 0
3 years ago
Other questions:
  • Why is the heart able to act as one unit? Why can all of the cells contract at the same time?
    6·1 answer
  • (04.01 LC) The levels of organization within an organism are atom, __________, cell, tissue, organ, and __________.
    15·2 answers
  • If you have a bacterial infection like pneumonia,could you take antibiotics?
    7·1 answer
  • Regions of strong _____________activity
    14·1 answer
  • The process by which plants,algea, and some bacteria use sunlight,CO2 and water make food is what
    6·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Bacteria clone themselves through?
    8·1 answer
  • Which of the following is a form of ethnic segregation that persists in the
    13·1 answer
  • Which cause of climate change can cause the Earth to get colder? Explain how.
    11·1 answer
  • if the frequency of the m allele in the human mn blood group system is 0.65 in a population at equilibrium, then the frequency o
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!