1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phoenix [80]
3 years ago
12

PLEASE HELP!!!!!

Biology
1 answer:
Brut [27]3 years ago
3 0

Answer:

hmm thats a hard one

Explanation:

tbh tbh tbht b

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
What are some similarities for prophase and telophase
sergey [27]

Answer:

Both prophase and telophase have a complete set of chromosomes and organelles.

5 0
3 years ago
Which tends to increase genetic variation in a population
klio [65]

Answer:

d. mutation

Explanation:

4 0
3 years ago
Give an example (except for a plant responding to light) of an organism's response to a stimulus.
kolezko [41]

Answer:

plants For example, phototropism is the plant's response to stimulus, i.e. sunlight. A plant hormone “auxin” keeps the plant's direction towards the sun by activating the growth in a particular part of a stem. Similarly, gravitropism in plants responds to the stimulus, i.e. gravity

Explanation:

mark me brainliest!!

4 0
2 years ago
History of the Atom Reading Comprehension
galben [10]

History of the Atom Reading Comprehension is stated below.

The Greek word atoms, which implies unable to cut or divide, is where the name "atom" originates. The atom was believed to be invisible at that time. In contrast to Democritus, Aristotle presented his own theory regarding the nature of matter. Democritus' thesis provided a clearer explanation of the situation, but Aristotle's ideas won out because of his greater stature.

According to his ethics, the only way to acquire eudaimonia—a state of bliss or contentment that is the highest form of human life—is by becoming wonderful. Dalton eventually looked more closely at gases as a result of his fascination with atmospheric pressures. John Dalton is well recognized for his contributions to human optics and for introducing the atomic theory to chemistry.

After discovering the electron, Thomson went on to suggest a model for the atom's structure. In Thomson's "plum pudding" atom model, a positively charged "soup" was surrounded by negatively charged electrons. Thomson made this discovery after his research assistant Francis Aston used a mass spectrometer to fire ionized neon through a magnetic and electric field and noticed two unique deflections. Thomson came to the conclusion that neon existed in two isotopes with distinct masses.

Learn more about atmospheric pressure here-

brainly.com/question/15300008

#SPJ9

3 0
1 year ago
Other questions:
  • A ____ refers to the expressed variation of a trait in a population. marine
    11·1 answer
  • Which of the following is not a reason why observed genetic distances between species do not reflect the actual distances?
    5·1 answer
  • The left ventricular wall of the heart is thicker than the right wall in order to ____.
    6·1 answer
  • Chronic exposure to nicotine desensitizes _______ receptors in the midbrain.
    14·1 answer
  • What are characteristics of a plant?
    6·1 answer
  • Why do land plants need to conserve water
    9·1 answer
  • Nonpoint source pollution is difficult to control because it _______. a. comes from a direct point of origin b. comes from a var
    7·1 answer
  • the following statement: "it [the canal] was justly hailed as an enterprise of breathtaking boldness" is what? A. an opinion Bpe
    6·1 answer
  • how does the differences in shape between the long bones and flat bones contribute to their different functions
    9·1 answer
  • Ms. C has recently received a heart transplant. Unfortunately, she is producing large quantities of antibodies against antigens
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!