<h2>The three factors that influence </h2>
There are three factors which influence the value given to particular fiber identification are described as:
1. Shape of a man made fibre that are usually machine or hand made.
2. Fibre color with variety of different colors.
3. Fibre number with numerous numbering options
These above all affects the degree of fibre transfers.
A globe is a three dimensional model
<span>A </span>globe<span> is a </span>three-dimensional<span>, spherical, scale model of Earth (terrestrial </span>globe<span> or geographical </span>globe<span>) or other celestial body such as a planet or moon.</span>
Answer:
its color, its skin pattern so 2 speak
Explanation:
Hey there!
El Nino typically involves waters with a warmer than usual surface temperature, a flatter thermocline (cooler water moves to the surface), and weaker trade winds. As for La Nina, think of it as the opposite of El Nino. There will be stronger trade winds, and cooler surface water temperatures.
Hope this helps!
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’