1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
7

Describe the strength of the magnetic field at points a b and c in the image below. Explain your answers in the terms of magneti

c field lines.

Biology
1 answer:
Nastasia [14]3 years ago
5 0

The magnetic fields are strongest at point A and weakest at point C. The magnetic field lines can be used to indicate the strength of a magnet or magnetic field. The closer together the magnetic field lines the stronger the magnetic field.

Explanation:

The magnetic field line also shows the direction of the magnetic field, hence they are also considered vector fields because they have magnitude and direction. They usually have an arrow indicating that the field lines are moving from the north pole to the south pole. The lines also never cross and are always in closed loops.

Learn More:

For more on magnetic fields check out;

brainly.com/question/13559682

#LearnWithBrainly

You might be interested in
The spanish fly is a species of what insect
sveticcg [70]

The Spanish fly is a species of a beetle `

6 0
3 years ago
Explain the  stages of a spider life cycle
krek1111 [17]
There are three stages in the life cycle of a spider : - the first is embryonic stage, then the larval stage and finally nympho- imginal stage.
6 0
3 years ago
In this figure, a line through points X and Y will
Naddika [18.5K]

A picture is needed to answer.

7 0
3 years ago
Why is the shoreline considered an ever-changing environment? Select all that apply.
erik [133]
All of the answers would be correct,
hope this helped!! <span />
8 0
4 years ago
Read 2 more answers
Help please brainliest involved!!!
kogti [31]
The answer is

A

Behavior isolation is behaviors involved in mating which could also cause it to prevent mating
8 0
3 years ago
Read 2 more answers
Other questions:
  • The three types of ocean floor sediments are classified according to their _____
    15·2 answers
  • What is the membranous foldings increase the surface area in the mitochondria for respiration called?
    14·1 answer
  • a biologist discovers a new unicellular organism and classifies it as a prokaryote. the cell is very small, contains a cell memb
    15·2 answers
  • Why do all nuclei undergo mitosis at the same time?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following is part of the geometric model?
    7·2 answers
  • Pick any alternative energy, that you believe is best suited to use while saving the environment and discuss. (3-6) sentences.
    6·1 answer
  • What Causes liquids to rise and depends on the strength of adhesion?​
    7·2 answers
  • A skeleton muscle is a composition of several components bundled one into the other.
    8·1 answer
  • Most of the joints in the appendicular skeleton are __________ joints.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!