1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
7

Describe the strength of the magnetic field at points a b and c in the image below. Explain your answers in the terms of magneti

c field lines.

Biology
1 answer:
Nastasia [14]3 years ago
5 0

The magnetic fields are strongest at point A and weakest at point C. The magnetic field lines can be used to indicate the strength of a magnet or magnetic field. The closer together the magnetic field lines the stronger the magnetic field.

Explanation:

The magnetic field line also shows the direction of the magnetic field, hence they are also considered vector fields because they have magnitude and direction. They usually have an arrow indicating that the field lines are moving from the north pole to the south pole. The lines also never cross and are always in closed loops.

Learn More:

For more on magnetic fields check out;

brainly.com/question/13559682

#LearnWithBrainly

You might be interested in
What three factors influence the value given to particular fiber identification
olchik [2.2K]
<h2>The three factors that influence </h2>

There are three factors which influence the value given to particular fiber identification are described as:                      

1. Shape of a man made fibre that are usually machine or hand made.

2. Fibre color with variety of different colors.

3. Fibre number with numerous numbering options

These above all affects the degree of fibre transfers.

7 0
3 years ago
Help me reward gets BRAINLIEST
ohaa [14]
A globe is a three dimensional model 
<span>A </span>globe<span> is a </span>three-dimensional<span>, spherical, scale model of Earth (terrestrial </span>globe<span> or geographical </span>globe<span>) or other celestial body such as a planet or moon.</span>
4 0
3 years ago
How can you recognize the difference between a fatally poisonous scorpion and a scorpion that is not harmful to humans?
DedPeter [7]

Answer:

its color, its skin pattern so 2 speak

Explanation:

8 0
2 years ago
Explain the difference between El Nino and La Nina.
MAVERICK [17]

Hey there!

El Nino typically involves waters with a warmer than usual surface temperature, a flatter thermocline (cooler water moves to the surface), and weaker trade winds. As for La Nina, think of it as the opposite of El Nino. There will be stronger trade winds, and cooler surface water temperatures.

Hope this helps!

6 0
3 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Other questions:
  • The principles of dominance, segregation, and independent assortment were first described by
    13·1 answer
  • Study the diagram of radioactive decay. An unstable atom with arrows showing movement away creates a new atom. Which options ide
    5·2 answers
  • Salt water is classified as a
    10·2 answers
  • Can someone help me with this question please :)
    13·1 answer
  • 1. Identify the taxa labeled A, B, C, and<br> Din the chart.<br> A.<br> B.<br> C.<br> D.
    11·1 answer
  • HELP MEE<br> Its about bio and its confusing
    13·2 answers
  • PLEASE HELP ASAP I'LL GIVE BRAINLIEST!!
    11·1 answer
  • Which of these is NOT an interaction between a plant's root and shoot systems?
    6·1 answer
  • While examining the scene of a murder, Investigator Allen notes that the newspaper is opened on the kitchen table. He concludes
    11·2 answers
  • Help please
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!