1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
drek231 [11]
3 years ago
6

Which of the following questions would BEST

Biology
1 answer:
34kurt3 years ago
8 0

Answer:

C

Explanation:

Glucose is the end result of the calvin cycle. It is not Oxygen, NADPH, or ATP because those are produced in the light reactions.

You might be interested in
Compared with nuclear families, extended families typically _____.
AnnyKZ [126]
Include grand parents.

Nuclear family is a family group with 2 parents and their children. This is a type of family structure.  It typically centered on married couple. This is in contrast to other family group such as single parent, extended types. Extended family extends beyond the nuclear family usually extended by grand parents. Usually they live under one roof. Certain family structure has advantages and disadvantages. This is also affected by the culture and way of living of the family. 
7 0
3 years ago
Read 2 more answers
Explain the role of lipids, carbohydrates, and proteins in the cell membrane.
koban [17]

Lipids provide structure - allow the selective diffusion. Proteins provide structure - involved transport - involved in cell adhesion. Carbohydrates are involved in cell recognition - receptor complexes.

<h3>What is the function of lipids, carbohydrates, and proteins in the cell membrane?</h3>

The cell membrane is composed of a lipidic bilayer, cholesterol, proteins, and glucans incrusted in between.

⇒ Lipids

  • Phospholipids are amphipathic molecules.

  • They have hydrophilic heads facing the exterior and the interior of the cells and hydrophobic tails that arrange against each other in the interlayer space.

  • Lipids can easily change places with other lipids by lateral diffusion  and transversal diffusion.

  • Their function is to provide structure to the membrane and allow the diffusion of some selected small molecules.

⇒ Cholesterol

These lipidic molecules play a significant role in membrane formation and structure. They are embedded in the membrane in between phospholipidic tails.

⇒ Carbohydrates

Carbohydrates are significant energy store molecules.

Carbohydrates get attached to lipids and proteins on the outer side of the membrane (glycolipids and glycoproteins).

Complexes protein-carbohydrate are used to identify and differentiate the cell and work as receptors.

Carbohydrates are also involved in cell adhesion.

⇒ Proteins

  • Among the proteins, we can find integral proteins and peripheric proteins.

Integral proteins are permanently associated with the membrane. They accomplish many different functions such as substances transport, cellular receptors, and cellular adhesion, among others.

According to how they are incrusted in the lipidic bilayer, integral proteins might be,

→ Transmembrane proteins ⇒ they cross the two lipid layers of the cell membrane.                       

→ Monotypic integral proteins ⇒ they can be found tied to one of the lipidic layers.

Integral proteins provide structure to the plasmatic membrane.

Periferic proteins are in the internal or external surface but not incrusted in the membrane.

In conlusion,

  • Phospholipids are the basic elements of the cell membrane. They are arranged in two layers, and thanks to their motion properties, they allow passive transport (diffusion) of some substances.

  • Proteins provide structure, are involved in facilitated and active transport, and are involved in cell adhesion.

  • Carbohydrates are involved in cell recognition and in receptor complexes.

You can learn more about membrane composition at

brainly.com/question/15651273

#SPJ1

7 0
2 years ago
_____ secrete chemicals that cause pores to form in the membrane of abnormal cells, leading to cell death.
qaws [65]
Hi, Natural Killer Cells secrets chemicals that cause pores to form in the membrane of abnormal cells, leading to cell death.
Hope this helps, please hit the thanks button and brainliest.
7 0
3 years ago
Match the following items
Svetach [21]
Ufkksjsjdndbdjdmejrhfjnebdjd
7 0
3 years ago
Read 2 more answers
On what does the allelic frequency in a population depend
r-ruslan [8.4K]
The correct answer would be D my friend had this same question on FLVS and this was correct :) 
7 0
3 years ago
Read 2 more answers
Other questions:
  • Your cousin returns from a trip to caves from around the globe. He shows you some snot-like
    9·1 answer
  • Why are doctors and parents so quick to seek a surgical "fix" for babies who are born intersex?
    7·1 answer
  • WILL GIVE BRAINLIEST
    14·2 answers
  • What makes a hot spring hot?
    15·1 answer
  • Which of the following is not a characteristic of pioneer species ?
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • I need to know what is the answer for number 6 and 7 and that’s all
    13·1 answer
  • Which of the following identifies the type of tissue organ x made out of an physiological process is involved in?
    11·1 answer
  • _: the rate at which electric charge passes a point in a circuit.
    14·1 answer
  • From where does a heterotroph directly obtain its energy?.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!