1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
13

I need help pls to do this​

Mathematics
1 answer:
VMariaS [17]3 years ago
8 0

Answer:

I don't plz like explain the question

You might be interested in
4. You purchase 3 items for $4.23. About how much did you spend?<br> $15<br> $12<br> $10<br> $13
statuscvo [17]

Answer:

you spend around 12 dollars to be exact 12.69 ha nice

7 0
2 years ago
Read 2 more answers
Help! Need help. Not good with this.
PIT_PIT [208]
The first answer is 7.7

the second one is 137.5
8 0
3 years ago
Read 2 more answers
A random sample of 56 fluorescent light bulbs has a mean life of 645 hours. Assume the population standard deviation is 31 hours
bezimeni [28]

Answer:

Step-by-step explanation:

We want to determine a 95% confidence interval for the population mean.

Number of sample, n = 56

Mean, u = 645 hours

Standard deviation, s = 31 hours

For a confidence level of 95%, the corresponding z value is 1.96.

We will apply the formula

Confidence interval

= mean ± z ×standard deviation/√n

It becomes

645 ± 1.96 × 31/√56

= 645 ± 1.96 × 4.142

= 645 ± 8.12

The lower end of the confidence interval is 645 - 8.12 =636.88

The upper end of the confidence interval is 645 + 8.12 =653.12

Therefore, with 95% confidence interval for the population mean life of fluorescent light bulbs is between 636.88 hours and 653.12 hours

3 0
3 years ago
Please help with number 9,10,11 thank you
beks73 [17]

Answer:

I know the first one is A/the first one don't know the other ones

Step-by-step explanation:

6 0
3 years ago
Please help me anyone
Ahat [919]

Answer:

4p\geq 12

Step-by-step explanation:

So, when there were 4 innings left, the score was 17 to 6 and Kim was losing.

Since the score was 17 to 6, in order for her to win, they must've scored <em>at least</em> another 12 points.

This is because we are told that the other team didn't score, so their final score is 17.

And for Kim to win, they must have more points, so their must've scored at least 12 points for their score to be 18.

And we also know that they scored the same per inning for the next four innings.

Thus, in an inequality, this is:

4p\geq 12

The score per inning times 4 innings must be greater than or equal to 12:

Further notes:

To solve, divide both sides by 4:

p\geq 3

In other words, Kim's team must've scored at least 3 points per inning.

Also note that this solution include <em>only integers</em>, since you can't score 3.5 points.

7 0
3 years ago
Other questions:
  • Can someone explain this better then my teacher?
    15·1 answer
  • Fractions. answer the question EXPLAIN.
    12·1 answer
  • 4. The area of a rhombus with one diagonal is 8.72 cm long is the same as the area of a square of side 15.6 cm. Find the length
    12·1 answer
  • Answer both questions if u cant see all the answers it don't matter all u need is the question
    8·2 answers
  • Darren wins a coupon for $4 off the lunch special for each of five days he pays $75 for his 5 lunch specials write and solve an
    12·1 answer
  • Choose the multiplication equation that is related to the division equation seven divided by one sixth.
    9·1 answer
  • Fill in the blank. Given below, you can conclude that so is congruent to<br><br> B
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • If the diameter of a circle with a circumference of 12.6 mm is divided by 2, what is the circumference of the new circle?
    15·2 answers
  • Can someone plz help me
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!