1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
3 years ago
14

Why do plants need glucose select 2 answers I will give a brainless pls answer correctly

Biology
1 answer:
patriot [66]3 years ago
5 0

Answer:

To make ATP through cellular respiration.

To make cell wall.

Explanation:

You might be interested in
Is ok for your body not to let you cry??
I am Lyosha [343]

Answer:no

Explanation: Because the tears are made of a special salt that needs to come out of you to make you healthier

6 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
6. Develop Models You are in charge of coaching a team of runners for the next school year. They begin practicing a month before
erastovalidia [21]

As the coach of the team, it is good advice for athletes to keep strictly to their training schedule. Consistency is more important than periodic but prolonged training. This is because the latter tends to wear out the athlete physically and creates longer come-back inertia.

<h3>What is a Training Schedule</h3>

A Training Schedule is a plan that you must design to ensure that you support a team of athletes with the required amount of training. A properly designed schedule will contain:

  • Calendar of training to be introduced to the students;
  • Details of the training and other related agenda
  • List of trainees and trainers

See the link below for more about Training Schedule:

brainly.com/question/3524635

<h3 />

4 0
3 years ago
4. Ribosomes are made up of _____.
Crazy boy [7]

Ribosomes consist of two major components: the small ribosomal subunits, which read the RNA, and the large subunits, which join amino acids to form a polypeptide chain.

You can read more about it on wikipedia. Hope I helped!! :)

8 0
3 years ago
The human heart is an organ that is made up of cells. Not all of the cells that make up the heart are identical, however. What n
slava [35]

Answer:

The correct answer would be D)  tissue.

In biology, the level of organisation from simplest to complex level can be summarized as:

Organelles → cells → tissues → organs → organ systems → organisms → populations →communities → ecosystem → biosphere.

It is clear that tissue is organization level that exists between cells and organs.

When similar cells are assembled together to perform specific function, the assembly or this organization is said to be the tissue.

There can be different types of tissues such as muscle tissue, nerve tissue et cetera.

Similarly, tissues arrange themselves to carry out specific function in the form of organ.

For example, heart is made up of cardiac tissue.

4 0
3 years ago
Read 2 more answers
Other questions:
  • When a newly formed cell enters into interphase and begins conducting metabolic functions, it is in _____.
    9·1 answer
  • Which term refers to the process by which individuals that are better adapted to their environment are more likely to survive an
    5·2 answers
  • Which of the following is an example of a eukaryote? E. coli Amoeba Salmonela
    14·2 answers
  • When evaluating a source, which of the following is the most important thing you should ask yourself?
    15·1 answer
  • What is the major organ of the integumentary system?
    7·1 answer
  • Which is part of the amphibian reproductive and development processes?
    10·1 answer
  • Subunits of skeletal muscle fibers that are composed of sarcomeres are called ________. Subunits of skeletal muscle fibers that
    5·1 answer
  • 2. in an experiment a student measured the maximum mass of sugar in grams that can dissolve in 100 mL of water
    7·1 answer
  • Question 1
    9·1 answer
  • which compound is not a protease that acts in the small intestine? a. chymotrypsin b. elastase c. enteropeptidase d. secretin e.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!