1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
3 years ago
14

Why do plants need glucose select 2 answers I will give a brainless pls answer correctly

Biology
1 answer:
patriot [66]3 years ago
5 0

Answer:

To make ATP through cellular respiration.

To make cell wall.

Explanation:

You might be interested in
One of the "triggers" proposed for the Cambrian explosion is a dramatic rise in oxygen concentrations that occurred in the ocean
ZanzabumX [31]

Answer:

1. Oxygen is an effective final electron acceptor in cellular respiration because of its high electronegativity.

2. Organisms that use it as a final electron acceptor can produce more usable energy than organisms that do not use oxygen, but only if it is available.

3. With more available energy, aerobic organisms can grow larger and move faster.

Explanation:

1. Cellular respiration is an aerobic pathway because oxygen is an electron acceptor. This process produces 38 molecules of ATP per glucose. The atomic elements that are positioned at the right of the periodic table have high electronegativities because they tend to be electron acceptors.  

2. The efficiency of energy production of aerobic respiration is much higher compared to the anaerobic respiration because this metabolic pathway (aerobic respiration) can produce 38 molecules of ATPs per glucose molecule, while anaerobic respiration produces only 2 ATPs by glucose.

3. A higher amount of available energy improves the metabolic profile of the organisms with aerobic respiration.

3 0
3 years ago
What is the simplest level of organization in a human being?
kkurt [141]
<h3> Chemical level is the simplest level of organization in a human being. </h3>

8 0
3 years ago
In 1953, the scientists James Watson and Francis Crick published their landmark findings on the structure of DNA. Watson and Cri
Digiron [165]

Answer:

The correct selection of answers to the question: Identify the pieces of evidence describing the features of DNA that Watson and Crick used to determine the structure of DNA, would be:

C: The two chains are parallel, both running in a 5´ to 3´ direction

D: A purine base forms hydrogen bonds to pair with a pyrimidine base located on the opposite DNA strand. Specifically, A pairs with T, and C pairs with G.

E: The sugar-phosphate backbones of each DNA helix run antiparallel to one another

F: The diameter of the DNA doube helix is 2 nm, with each purine-pyrimidine base pair spanning an equivalent distance between the two chains.

Explanation:

Although Watson´s and Crick´s research, and model of the DNA helix, became the breakthrough for science, as it visually presented the now known characteristics of DNA, this research was possible due to the way that these two researchers used previous information found by other scientist on the molecule, to finally build their model. All of the options that were selected were part of the research of several scientis, including Mendel, Rosalin Franklin, Linus Pauling, Maurice Wilkins, Oswald Avery and many others, who worked on different aspects of specimens and their specific characteristics, and which led them to discover that organisms possessed DNA, that this was the unit of information that directed all functions in living cells and how this DNA helix was chemically built to understand how it worked, and why it worked the way it did.

8 0
3 years ago
A. Mutualism
EleoNora [17]

Answer: parasitism

Explanation: Because it's relationship between two species of plants or animals in which one benefits at the expense of the other, sometimes without killing the host organism.

7 0
3 years ago
When is DNA replicated in a cell?
Tasya [4]

Answer:

during s- phase

Explanation:

3 0
3 years ago
Other questions:
  • In which two locations does cellular respiration occur? a: chloroplast b: cytoplasm c: nucleus d: mitochondrion e: plasma f: mem
    5·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • How does each of these homologous structures functions in each animal?
    6·1 answer
  • How is science different from other branches of knowledge​
    8·2 answers
  • Which type of organism is responsible for performing the majority of nitrogen fixation..??
    6·2 answers
  • . . The study of animals' structures, behaviors, functions, and evolution is called _____Select one from the choices given: etho
    6·1 answer
  • a student does an experiment for a science fair to study whether temperature affects the timing of crickets chirpthe student kee
    11·1 answer
  • In a signal transduction pathway, fine tuning of the cellular response occurs in several steps. Which of the following best desc
    10·1 answer
  • When the land or oceans are heated unevenly,
    5·2 answers
  • Describe the function of each organelle.<br> Endoplasmic reticulum
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!