1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
3 years ago
6

The process of dna replication occurs just before

Biology
1 answer:
djverab [1.8K]3 years ago
5 0

the process of DNA replication occurs just before the cell division i.e. mitosis. DNA synthesis happens in S-phase i.e. synthesis phase of interphase where cell division preparation happens.

PLEASE MARK ME AS BRAINLIEST

You might be interested in
PLZ HELP I NEED IT DONE ASAP PLS I AM BEGGING I WILL MARK BRAINLESIET
sleet_krkn [62]

bam...easy...............

7 0
3 years ago
THe hydrolysis of triglycerides on a spirit blue agar plate most closely resembles that of __________ hemolysis on a blood agar
patriot [66]

The hydrolysis of triglycerides on a spirit blue agar plate most closely resembles that of beta hemolysis on a blood agar plate.


The hydrolysis of triglycerides on a spirit blue agar plate is used for identifying bacteria based on what organic compounds they can break down, in this case lipids. Spirit blue agar is a medium that contains a supply of lipids. If bacteria have lipase, the enzyme capable of breaking down lipids spirit blue agar will be digested and it will appear as a halos around colonies of bacteria that make lipase.


The ability of bacterial colonies to induce hemolysis (the breakage of red blood cells) when grown on blood agar is used to identify microorganisms. Beta hemolysis is a complete lysis of red blood cells and in the blood agar, that area under the colonies that do the hemolysis appears lightened and transparent.



5 0
3 years ago
Read 2 more answers
Some animals are adapted to survive in very cold conditions such as the Arctic.
iVinArrow [24]

Answer: they grow thick fur for insulation which is also oily and they have a layer of fat which keeps their get inside their body to keep them warm for longer

Explanation:

6 0
3 years ago
When an enzyme affects a biological reaction, _____.
Dennis_Churaev [7]
I believe it is (B) It is not used up
 
Hope this helps!

- Rainbow :3
4 0
3 years ago
Need help ASAP!
Veronika [31]
The primase generates short strands of RNA that bind to the single-stranded DNA to initiate DNA synthesis by the DNA polymerase. ...Lagging-strand<span> replication is discontinuous, with short Okazaki fragments being formed and later linked together.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!</span>
7 0
3 years ago
Other questions:
  • Which molecule listed below contains the most carbon atoms
    5·1 answer
  • Whether the external temperature is hot or cold, birds maintain an internal body temperature of approximately 40°c. this is an
    14·1 answer
  • Which of the following statements is true?
    12·2 answers
  • Assume you are working for a chemical company and are responsible for growing a yeast culture that produces ethanol. The yeasts
    8·1 answer
  • How does putting salt on frozen roads make the roads less icy?
    10·2 answers
  • Why is it important to be able to date fossils?
    12·2 answers
  • Allows the cell membrane to engulf large molecules.<br> Diffusion<br> Osmosis<br> Active Transport
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following is a correctly written scientific name in proper binomial nomenclature?
    13·2 answers
  • Can a person live without salivary glands
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!