1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
13

Some animals are adapted to survive in very cold conditions such as the Arctic.

Biology
1 answer:
iVinArrow [24]3 years ago
6 0

Answer: they grow thick fur for insulation which is also oily and they have a layer of fat which keeps their get inside their body to keep them warm for longer

Explanation:

You might be interested in
All you need to know is in the pic bellow
algol13

Answer:

D.

Explanation:

5 0
3 years ago
Read 2 more answers
The shape of a protein is determined by ?
kumpel [21]
The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides in the gene (DNA) encoding it.
3 0
3 years ago
In the context of single joint exercises of extremities representing an open kinetic chain, the core of the body and the proxima
Sonbull [250]

Answer: joint isolation exercises

Explanation:

8 0
2 years ago
Read 2 more answers
The molecules in the image below are able to move across the cell
frutty [35]

Answer:

A

Explanation:

3 0
3 years ago
Which of the following is a
Levart [38]
B Hope this helped!!
8 0
3 years ago
Read 2 more answers
Other questions:
  • The collection of all chromosomes in an organism is their what
    9·1 answer
  • How many types of immunoglobulins are there in human body?​
    5·1 answer
  • What are the polymers of glucose????
    11·1 answer
  • He ________ is located deep within the brain, and it includes structures such as the substantia nigra and ventral tegmental area
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • During the light-independent reactions of photosynthesis, carbon dioxide is combined with hydrogen to form sugars. What is the e
    10·2 answers
  • *Penguins are adapted to live in the antarctic. Which of the following is
    12·1 answer
  • What are mica and quartz? A. plants B. animals C. soil D. minerals​
    6·1 answer
  • A group of three letters on DNA is called?
    8·1 answer
  • What cell is in planarian and humans
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!