1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gayaneshka [121]
3 years ago
7

What would be the correct genotypes if you cross two (2) heterozygous guinea pigs?

Biology
2 answers:
patriot [66]3 years ago
6 0

Answer:

Hh x Hh

Explanation:

A capital and lower cap letter represent this.

Two capital letters represent a pure dominant trait.

Two lower cap letter represent a pure recessive trait.

polet [3.4K]3 years ago
3 0

Answer:

Hh x Hh

Explanation:

this popped up for me even tho its month old u m

You might be interested in
The ion imbalance known as ________ initially leads to ________ in excitable cells
saveliy_v [14]
Hyperkalemia, depolarization
Hope this helps.
3 0
3 years ago
Look at the graph below. Which statement is true based on the graph of an egg draw. A the speed of the egg is constant B the egg
Dmitriy789 [7]
If there was a graph i could help

5 0
3 years ago
3. Name the six kingdoms of life, and give two charac-<br>teristics of each.​
IRISSAK [1]

Answer:

Animalia - multicellular, eukaryotic

Plantae - vacuolate eukaryotic cells, multicellular

Protista - unicellular and multicellular, eukaryotic

Fungi - decomposers, non-motile

Eubacteria - unicellular, prokaryotic

Archaebacteria - no peptidoglycan, glycoproteins and polysaccharides in cell walls.

Hope that helps. :)

3 0
3 years ago
Why are fossil fuel limited in their supply
Licemer1 [7]

Because they are non renewable sources of energy and they took billions of years to form.

8 0
3 years ago
Which body system is responsible for motion in humans?
IRINA_888 [86]

Answer:

<h2>Muscular System.... off course</h2>

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following correctly describes the relationship between speed and velocity?
    5·1 answer
  • What Helps Plants Maintain Homeostasis
    14·1 answer
  • The rate of species extinction on Earth is currently very high—perhaps as high as it has been since the time of the dinosaur ext
    11·2 answers
  • Arianne recently traveled abroad where she enjoyed eating food from different countries and learning about different cultures. A
    7·2 answers
  • You are riding a roller coaster. At what point in the ride is the system in a state of equilibrium?
    9·2 answers
  • Which of the following increases the strength of the hydrophobic interactions in lipid bilayers, and thus makes them less permea
    6·1 answer
  • HELP PLEASE//40POINTS AND I GIVE BRAINLIEST
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Pure water is neutral.what is the appropriate justification for this?
    13·1 answer
  • What did Elijah Muhammad overcome?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!