1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
attashe74 [19]
3 years ago
5

Las células procariontes pueden formar tejidos?, ¿por qué?

Biology
1 answer:
Kamila [148]3 years ago
4 0
No forman tejidos, cuando se agrupan forman colonias. Algunas células procariotas poseen: - Pared celular por fuera de la membrana
You might be interested in
The most common type of electronic evidence is
Gre4nikov [31]
Email bc its most used
8 0
3 years ago
Place the following statements in the correct order in the blanks below to describe how gas
bekas [8.4K]

The correct order in the blanks is as follows <u> </u><u>E D C E A B A C E</u>

Moves through open stomata diffuses through spongy tissue layer CO2(g) is converted into O2(g).  Moves through open stomata diffuses into air pockets and diffuses into palisade cells.  Diffuses into air pockets CO2(g) is converted into O2(g) moves through open stomata.

<h3>What is photosynthesis?</h3>

Plants use sunlight, water, and carbon dioxide to produce oxygen and energy in the form of sugar in a process known as photosynthesis.

When performing photosynthesis, plants utilize the ambient carbon dioxide and release the oxygen gas they create into the atmosphere. Gas exchange is the term for this. Stomata, a unique part of the plant's leaf, are used to accomplish this. The guard cells that surround the stomata become turgid or flaccid in response to the entry or escape of water molecules, respectively. Stomata open and gas exchange occurs when the guard cells become turgid, or the other way around.

For more information regarding photosynthesis, visit:

brainly.com/question/19160081

#SPJ1

7 0
2 years ago
What is the minimum recommended weight gain for the obese pregnant woman?
Svetradugi [14.3K]
That's 11 to 20 lbs. (about 5 to
9 kg)
6 0
3 years ago
- Chargaffs rule states...
denis23 [38]

Answer:

Option C

Explanation:

For chagarff's rule, it clearly states that DNA from any cell of any organisms be it prokaryotes or eukaryotes should have the basic 1 (purine): 1 (pyrimidine) ratio. Particularly, amount of adenine should be equal to thymine, and guanine equal to cytosine. This is in particular reference to organisms that have double stranded DNA.

5 0
3 years ago
Which statement best explains how respiration and photosynthesis are related to one another?
PIT_PIT [208]

Answer: D

Explanation:

photosynthesis - takes in water, energy from the sun, and carbon dioxide and releases oxygen and glucose (sugar)

respiration - takes in glucose and oxygen, and releases water and carbon dioxide and energy

they are basically the opposite

HAVE A GREAT DAY :)

6 0
3 years ago
Other questions:
  • Photosynthesis lab gizmo<br> answer key??
    12·2 answers
  • Which vitamin is synthesized in the body with the help of sunlight?
    11·1 answer
  • Vessels which carry blood away from the heart
    7·1 answer
  • Autotrophic organisms require other organisms to produce their own food.<br><br> True ot false.
    6·2 answers
  • What is one difference between a cell wall and a cell membrane
    5·2 answers
  • What are the products of the light reactions that are subsequently used by the Calvin cycle?
    12·1 answer
  • What are chromosomes made of?<br> a. Gametes<br> b. Carbohydrates C)DNA D)Tetrads
    13·1 answer
  • Grow taller.
    14·1 answer
  • In your own words, describe what a Punnet square shows you about combinations of alleles.
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!