1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tresset [83]
3 years ago
11

The "Nutrition Facts" on a label of a 16 fluid ounce container of apple juice states that a serving size is 8 fluid ounces conta

ins 176 Calories and 240 milligrams of potassium.
Nutrition Facts
Serving Size 8 fl. oz. (240mL)
Servings Per Container: 2
Amount Per Serving
Calories 176
% Daily Value*
Total Fat 0g 0 %
Sodium 32mg 1 %
Potassium 240mg 6 %
Total Carbohydrate 29g 10 %
Sugars 26g
Protein 0g
a) How many calories would 1 fluid ounce of apple juice contain?


b) How many milligrams of potassium would 1 fluid ounce of apple juice contain?
Chemistry
1 answer:
spayn [35]3 years ago
4 0

Answer:

a) 22 calories

b) 30 mg

Explanation:

Divide number of cal or mg of pot by 8 fl oz.

You might be interested in
Every day on his ride to school, Max sees some sedimentary rock. He starts to wonder: Could material from this sedimentary rock
Sloan [31]

Material from this sedimentary rock ever forms igneous rock, <u>Option D. Yes, if the sedimentary rock is moved below Earth’s outer layer and exposed to energy from Earth’s interior, it can melt into liquid rock and form </u><u>igneous rock.</u>

Sedimentary rocks are shaped from pre-existing rocks or pieces of soon-as-dwelling organisms. They form from deposits that collect on this planet's floor. Sedimentary rocks regularly have special layering or bedding.

Igneous rock, or magmatic rock, is one of the 3 primary rock kinds, the others being sedimentary and metamorphic. Igneous rock is shaped via the cooling and solidification of magma or lava. The magma may be derived from partial melts of existing rocks in either a planet's mantle or crust.

Learn more about igneous rocks here:-brainly.com/question/6533375

#SPJ1

<u>Disclaimer:- your question is incomplete, please see below for the complete question.</u>

Every day on his ride to school, Max sees some sedimentary rock. He starts to wonder: Could material from this sedimentary rock ever form igneous rock?

A. No, igneous rock can only form out of other igneous rocks. Sedimentary rock cannot change into igneous rock.

B. No, igneous rock forms under Earth’s outer layer due to energy from Earth’s interior, but the sedimentary rock is only at Earth’s surface.

C. Yes, if the sedimentary rock is exposed to energy from the sun at Earth’s surface for a long enough time, it can melt into liquid rock and form igneous rock.

D. Yes, if the sedimentary rock is moved below Earth’s outer layer and exposed to energy from Earth’s interior, it can melt into liquid rock and form igneous rock.

3 0
1 year ago
How does the shape of a molecule affect the polarity of the molecule?
ruslelena [56]

Answer:

It is A

Explanation:

If you think about it, no-polar covalent bonds are in a symmetrical line, and polar bonds are on the diagonals of the center atom.

I hope I helped :)

5 0
3 years ago
At what celsius temperature does 0.750mol of an ideal gas occupy a volume of 35.9L at 114kPa
pashok25 [27]

Answer:

378.25°C

Explanation:

Given data:

Number of moles of gas = 0.750 mol

Volume of gas = 35.9 L

Pressure of gas = 114 KPa (114/101 = 1.125 atm)

Temperature of gas = ?

Solution:

The given problem will be solve by using general gas equation,

PV = nRT

P= Pressure

V = volume

n = number of moles

R = general gas constant = 0.0821 atm.L/ mol.K  

T = temperature in kelvin

now we will put the values.

T = PV/nR

T = 1.125 atm × 35.9 L /0.750 mol  × 0.0821 atm.L/ mol.K

T = 40.3875/0.062/K

T = 651.4 K

Kelvin to °C:

651.4 K - 273.15 = 378.25°C

8 0
4 years ago
A particular oral contraceptive contains 0.038 mg of ethinyl estradiol in each pill. The formula of this compound is C20H24O2. H
Ray Of Light [21]

<u>Answer:</u> The number of molecules of ethinyl estradiol present in one pill are 7.71\times 10^{16}

<u>Explanation:</u>

To calculate the number of moles, we use the equation:

\text{Number of moles}=\frac{\text{Given mass}}{\text{Molar mass}}

Given mass of ethinyl estradiol = 0.038 mg = 3.8\times 10^-5}g    (Conversion factor: 1 g = 1000 mg)

Molar mass of ethinyl estradiol (C_{20}H_{24}O_2)=[(20\times 12)+(24\times 1)+(2\times 16)]=296g/mol

Putting values in above equation, we get:

\text{Moles of ethinyl estradiol}=\frac{3.8\times 10^{-5}g}{296g/mol}=1.28\times 10^{-7}mol

According to mole concept:

1 mole of a compound contains 6.022\times 10^{23} number of molecules

So, 1.28\times 10^{-7}mol of ethinyl estradiol will contain = (1.28\times 10^{-7}\times 6.022\times 10^{23})=7.71\times 10^{16} number of molecules

Hence, the number of molecules of ethinyl estradiol present in one pill are 7.71\times 10^{16}

5 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • The flow of insecticides from farm fields in an area is an example of which type of pollution?
    12·2 answers
  • How has the Canadarm affected our society and environment in a good and bad way?? ( please make it easy and readable)
    8·1 answer
  • What functional groups are present in salicylic acid? aspirin?
    6·2 answers
  • Two solids are mixed in a flask and stirred. After a few minutes, the flask becomes cold.
    12·2 answers
  • Jimmie places a soccer ball on the ground and kicks it toward the goal. The ball moves along the ground toward the goal. Why doe
    7·2 answers
  • Is distled water a soft water or not?​
    8·1 answer
  • Can tell the answer pls
    11·1 answer
  • What happens when light hits the pigment in photosystem II?
    7·1 answer
  • What did the geologist likely observe in the environment to draw this conclusion?
    6·1 answer
  • An iron bar at 200°C is placed in thermal contact with an identical iron bar at 120°C in an at isolated system. After 30 minutes
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!