1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
2 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]2 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
How will you describe the behavior of dry ice?​
Ganezh [65]

Answer:

Explanation: A square of dry ice has a surface temperature of - 109.3 degrees Fahrenheit (- 78.5 degrees C). Dry ice additionally has the extremely decent component of sublimation - as it separates, it transforms legitimately into carbon dioxide gas as opposed to a fluid.

6 0
3 years ago
Mass is measured against a standard by using a balance. <br> a. True<br> b. False
jok3333 [9.3K]
Mass is measured against a standard by using a balance. The statement given above is a fact. Therefore the answer among the choices is letter "A" or "A. True". I hope this helps you on your assignment. 
6 0
3 years ago
Read 2 more answers
A solution of sodium hydroxide was titrated against a solution of sulfuric acid. How many moles of sodium hydroxide would react
jeka57 [31]

Answer:

2 mole of Sodium hydroxide reacts with 1 mole of Sulfuric acid

Explanation:

Write down the equation in the beginning with reactants and products:

NaOH + H₂SO₄ → Na₂SO₄ + H₂0

Now try to balance it. Try with Na first:

2NaOH + H₂SO₄ → Na₂SO₄ + H₂0

Na atoms are balanced. There are 6 Oxygen atoms on the right and 5 on the left. Balance by increasing the H₂O moles:

2NaOH + H₂SO₄ → Na₂SO₄ + 2H₂0

Check if H atoms are also balanced. They are. That means our final reaction is:

2NaOH + H₂SO₄ → Na₂SO₄ + 2H₂0

2 Moles of NaOH reacts with 1 mole of H₂SO₄

5 0
3 years ago
4. Why can't the subscripts be changed in a chemical equation in chemistry
neonofarm [45]
If you change the subscripts it would change the reactants or products and then you would be solving a different formula, you would change what the chemical is
4 0
2 years ago
A standard room temperature and pressure, most of the elements on the periodic table are
IgorC [24]
Gasses i’m pretty sure.
6 0
2 years ago
Read 2 more answers
Other questions:
  • Write the balanced equation for each of the following changes and identify whether heat is a product or needed to start the reac
    14·1 answer
  • Which term describes this reaction?<br> addition<br> condensation<br> elimination<br> substitution
    7·2 answers
  • A) How much CO is required for the production of Fe from 1000 tonnes of magnetite (Fe2O4). Assume that the iron ore is 100% pure
    13·1 answer
  • What is the change in entropy of the lead when 2.0 kg of molten lead at its melting point temperature solidifies.
    10·1 answer
  • Temperature is not a direct measure of the thermal energy of a system. The total thermal energy of a system depends on its tempe
    5·1 answer
  • Which of these requires accurate coefficients in a reaction?
    7·1 answer
  • Plz help
    14·1 answer
  • A crane lifts a 5,800-N block from the ground to 20 m above the ground in 80 seconds. How much Power
    14·1 answer
  • Water, H2O, is a molecule made of oxygen and hydrogen. The bonds that hold water molecules together are due to shared __________
    11·1 answer
  • Which word equation shows lithium oxide being formed from the reaction between oxygen and lithium? oxygen lithium oxide right ar
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!