1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]3 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
An atom with 4 protons and 4 neutrons Is called?
Bas_tet [7]

Answer:

i'm pretty sure it's beryllium

Explanation:

5 0
3 years ago
Read 2 more answers
Can someone please help me? :(
Dmitriy789 [7]
Answer:

Trade winds


Explanation:

I am not sure
7 0
2 years ago
acetaminophen is a stronger acid than methanol, and sodium methoxide is a stronger base than. write an acid base equilibrium rea
torisob [31]

Answer:

The equilibrium shifts to the right that is the forward reaction.

Explanation:

The chemical compound known as "Acetaminophen" is a chemical compound that is generally known to a layman as Paracetamol and it belongs to the drug class known as anagelsics which helps in the treatment of pain or say in the reduction of pain. Acetaminophen has the chemical Formula to be C8H9NO2, with the Molar mass of 151.163 g/mol and Boiling point of 420 °C.

The reaction between Acetaminophen and sodium methoxide gives methanol and acetaminophen sodium salt. Therefore, the acid base equilibrium reaction of these species is given as;

C8H9NO2 + CH3ONa <========> CH3OH + acetaminophen sodium salt.

The equilibrium shifts to the right that is the forward reaction.

8 0
3 years ago
The chemical formula for glucose (sugar) is C6H12O6. What are the individual numbers called in a chemical formula?
givi [52]

The individual numbers which are present in chemical formula is subscript.

<h3>What is chemical formula?</h3>

Chemical formula of any compound of chemistry consist more than one atoms in it and gives idea about the number of atoms present in that compound.

Given chemical formula of glucose is C₆H₁₂O₆.

In the given chemical formula of glucose, number which shows the amount of carbon, hydrogen and oxygen are known as subscripts.

Hence, individual number are subscript.

To know more about chemical formula, visit the below link:
brainly.com/question/1603500

#SPJ1

8 0
2 years ago
How many places are there electrons in the innermost shell of an atom
Sergio [31]
There are two places for electrons in the inner most shell
5 0
3 years ago
Other questions:
  • Explain why potassium and argon react together
    9·1 answer
  • What are 4 properties that krypton has?
    5·2 answers
  • Ammonia (nh3) is widely used as a fertilizer and in many household cleaners. how much ammonia is produced when 6.64 mol of hydro
    6·1 answer
  • What kind of chemical bonds are represented by the product in the following diagram?
    13·1 answer
  • Which of following increases the average kinetic energy of particles?
    9·1 answer
  • During a medical screening, lung capacity testing is a standard procedure.<br> a. True<br> b. False
    15·1 answer
  • What is wosutah unsrcambled
    15·1 answer
  • The walls in your home have 25mm of expanded polystyrene (R-value 3.96) and 25mm of rigid urethane foam (R-value 7.50). What is
    11·1 answer
  • List the objects from the smallest to the largest mass.
    13·1 answer
  • for each compound write a complete reaction equation showing the removal of the atoms that become the water molecule
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!