1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]3 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
Which one of the following
mariarad [96]

Answer:

5

Explanation:

6 0
3 years ago
According to Le Chatelier's principle, what happens to the equilibrium constant (K) when the concentration of the reactants is d
slavikrds [6]

Answer:

The value of the equilibrium constant (K) remains the same.

Explanation:

A state of dynamic equilibrium is said to have been achieved in a reaction system when the rate of forward reaction equals the rate of reverse reaction.

At equilibrium, doubling the initial concentration of reactants have no effect on the equilibrium constant K. The equilibrium will rather shift to the left or right as required in order to annul the constraint.

5 0
3 years ago
Read 2 more answers
The active ingredient in aspirin is acetylsalicylic acid (MW = 180.2 g/mol). An aspirin tablet was dissolved in
Mashcka [7]

Answer:

1214 mg

Explanation:

Data given

Volume of NaOH solution (V) = 14.85 mL

Molarity of NaOH solution (M) = 0.100 M NaOH.

Amount of acetylsalicylic acid = ?

Molecular weight = 180.2 g/mol

Solution:

It is a acid base titration

As equal amount of NaOH will neutralize equal amount of acetylsalicylic acid.

First find the moles of NaOH

As we know

                 M = moles of solute / 1 L x volume of solution

Rearrange and modify the above equation

                 moles of NaOH = M of NaOH x 1 L / volume of NaOH solution

Put values in above equation

                moles of NaOH = 0.100 M x 1 L / 14.85 mL

                moles of NaOH = 0.0067 moles

Now find to find the weight of acetylsalicylic acid

As

equal amount of NaOH will neutralize equal amount of acetylsalicylic acid.

                 moles of acetylsalicylic acid =  moles of NaOH.......... (1)

As we know  

                  no. of moles = mass in g / molar mass

So,

The modified form of equation 1 will be

              mass in g / molar mass (acetylsalicylic acid) =  moles of NaOH

Put values in above equation

                  mass in g / 180.2 g/mol = 0.0067 moles

Rearrange the above equation

                mass of acetylsalicylic acid = 0.0067 moles x 180.2 g/mol

                 mass of acetylsalicylic acid = 1.214 g

Convert the grams to milligrams

1 g = 1000 milligram

So,  

1.214 g = 1214 mg

5 0
4 years ago
The fuel used in many disposable lighters is liquid butane, C4H10
Charra [1.4K]

Answer:

1.45 *10^23 atoms C

Explanation:

3.50 g butane * 1 mol butane/58.1 g butane =0.06024 mol butane

in 1 mol C4H10           -------- 4 mol C

in 0.06024 mol C4H10 -------- 4*0.6024 = 0.241 mol C

0.241 mol C * 6.02*10^23 atoms C/1 mol C = 1.45 *10^23 atoms C

6 0
3 years ago
When calcium carbonate reacts with hydrogen chloride, if the reaction occurs with 78.5% yield, what mass of carbon dioxide will
Vilka [71]
97.95 is the answer to the question
4 0
4 years ago
Other questions:
  • Physical and chemical properties
    10·1 answer
  • What is the correct complimentary strand for the following DNA?ATCGAG
    10·1 answer
  • If all the threonines of an antifreeze protein were changed to valines, what would happen to the protein's ability to bind and f
    7·1 answer
  • How many atoms are in 1 mole of hydrogen
    14·1 answer
  • L waves are seismic waves that
    5·1 answer
  • Which substance is formed when silica is melted (so that SiO 4 units are reorganized) and then cooled?
    9·1 answer
  • In testing the effectiveness of an antacid compound, 20.0g of Hydrochloric Acid is mixed with 28.0g of Magnesium Hydroxide. will
    8·1 answer
  • The device shown in the picture is used by electric utility power stations to produce electrical energy from _____ energy.A. Sol
    13·2 answers
  • What is a lie that black parent always lie about
    7·2 answers
  • Which of these does not belong on the list of biochemical samples?>
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!