1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]3 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
Is the narrator male or female in the story leaving?​
AlladinOne [14]
The narrator is a female

Hope this helps
8 0
3 years ago
Consider the following reaction
Fynjy0 [20]

Answer:

92.72 kJ

Explanation:

2 N₂ (g) + O₂ (g) —-> 2 N₂O

According to question , one mole of N₂O requires 163.2 kJ of heat

Molecular weight of N₂O = 44 gm

25 g  N₂O = 25 / 44 mole

25 / 44 mole will require 163.2 x 25 / 44 kJ

= 92.72 kJ

6 0
3 years ago
Which statement is true about air temperature and humidity
lapo4ka [179]

Complete Question:

Which statement is true about air temperature and humidity?

Group of answer choices.

a. the air temperature does not affect how much moisture the air can hold

b. hotter air holds less moisture than colder air.

c. hot air and cold air share the same amount of moist.

d. colder air holds less moisture than hotter air.

Answer:

d. colder air holds less moisture than hotter air

Explanation:

Weather can be defined as the atmospheric conditions of a particular area over a short period of time.

The elements of weather include precipitation, wind, temperature, atmospheric pressure, relative humidity, cloud, and wind speed.

Temperature can be defined as a measure of the degree of coldness or hotness of a physical object (body).

On the other hand, humidity refers to the concentration (amount) of water vapor that is present in the air. It is high when there's a lot of water vapor in the air and low when the level of water vapor is small.

Hence, the true statement about air temperature and humidity is that colder air holds less moisture than hotter air because as the air cools, its molecules move closer together while the molecules move farther apart as the air become hot.

Additionally, at constant humidity, relative humidity is inversely proportional to temperature i.e as the temperature decreases, relative humidity increases.

6 0
3 years ago
A dam is used to retain water. Retaining water can also lead to flooding. Which most likely would be a new societal issue result
pantera1 [17]
Habitat destruction of the ecosystem.
5 0
3 years ago
Read 2 more answers
Recycling one ton of paper is the equivalent of approximately how much of the following? a.) all of the below b.) 460 gallons of
jek_recluse [69]
I think the answer is a
5 0
4 years ago
Other questions:
  • Why hf has higher boiling point greater than nh3
    13·1 answer
  • What is the formula for cobalt(III) nitrate
    5·1 answer
  • Enlista cuatro compuestos del carbono,naturales y sintéticos, de uso en la vida cotidiana
    13·2 answers
  • The image shows sedimentary rock layers with index
    5·1 answer
  • What’s the equation to solid calcium oxide reacts with hydrochloric acid to form a solution of calcium chloride and water as it’
    6·1 answer
  • What transition energy corresponds to an absorption line at 460 nm?
    14·2 answers
  • Which countries have a Desert biome?
    7·1 answer
  • A what is matter that is always composed of the same combination of atoms
    15·1 answer
  • Advantages and disadvantages of chemical​
    11·1 answer
  • A gas has a volume of 62.65 L at STP. At what temperature (in oC) would the volume of the gas be 78.31 L at a pressure of 612.0
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!