1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
2 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]2 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
What is the pressure in atmospheres exerted by a 0.500 mole sample of nitrogen gas in a 10.0 L
Nonamiya [84]

Answer:

The pressure is 1, 22 atm.

Explanation:

We use deal gas formula. First, we convert the unit of temperature in Celsius into Kelvin. We use the constant R= 0,082 l atm /K mol.Then, we solve P (pressure).

0°C=273 K   25°C= 273 + 25= 298 K

PV=nRT   -----> P= (nRT)/V

P= (0,5 mol x 0,082 l atm /K mol x 298 K)/ 10 L

<em>P= 1, 2218 atm</em>

3 0
3 years ago
If two fluorine atoms bonded with each other what kind of bond would be involved?
Andrei [34K]
<span>If two fluorine atoms bonded with each other what kind of bond would be involved?
A. ionic
B. valence
C. covalent
D. non-metallic

C. covalent

</span>
7 0
3 years ago
Read 2 more answers
What coefficient would the O 2 have after balancing C 4 H 10 +O 2 CO 2 +H 2 O ?
nydimaria [60]

Answer: 6

Explanation:

6 0
3 years ago
Does an astronaut have more mass on earth then space? why or why not?
katovenus [111]

Answer:

No

Explanation:

No, his mass remains the same no matter where he is in the universe.

But then again the moon has less gravitational pull, therefore your weight and mass will be smaller in space and on the moon than on earth

I hope this was helpful! ;)

3 0
3 years ago
In reality, energy conversion from burning fuel is never 100% efficient. Significant loss of energy due to heating occurs. If th
algol [13]

Answer:

Electrical energy = 130000000 J and Heat energy = 520000000 J

Explanation:

Multiply the amount of joules from the last question (650000000) by .20 and .80. (Which are the percentages)

6 0
3 years ago
Other questions:
  • Question 8 4 pts What would be the resulting molarity of a solution made by dissolving 31.3 grams of Ca(OH)2 in enough water to
    8·2 answers
  • A saturated solution was formed when 5.16×10−2 L of argon, at a pressure of 1.0 atm and temperature of 25 ∘C, was dissolved in 1
    14·1 answer
  • A reaction occurs when solid X is placed into solution Y. As a result, the temperature of the new solution increases by 3°C.
    14·1 answer
  • Explain why materials with metallic lattice structures can be used to make wires and connections that conduct electricity in ele
    8·1 answer
  • One strategy to keep college tuition costs down is to attend a(n)
    11·1 answer
  • Arrange the metals used in this experiment (including H2 and Ag) in order of decreasing reactivity (most reactive metal first).
    9·1 answer
  • People were surveyed to find out which part of the smore they like best. The data is as follows: 75% chocolate, 20% marshmallow,
    10·1 answer
  • Complete ionic equation for CuSO4 and Zn(NO3)2
    5·2 answers
  • The colourless coating on a photographic film contains a chemical substance which reacts upon exposure to light, causing the fil
    5·1 answer
  • A substance is a base if it has a pH value greater than___<br>PLEASE ANSWER ASAP ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!