1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]3 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
Explain why the C―Ha bond is much more acidic than the C―Hb bond in pentan-2-one. Select the single best answer. 253 Ha is less
mafiozo [28]

Answer:

Ha is more acidic than Hb because loss of Ha forms a resonance-stabilized conjugate base.

Explanation:

The carbon atom that is next to the carbonyl group in pentan-2-one is known as the alpha carbon atom, this carbon atom bears the Ha, the alpha hydrogen atoms.

Ha is more acidic than Hb because, loss of Ha leads to the formation of a resonance stabilized enolate ion. This resonance stabilization of the ion formed makes loss of Ha an easier process than loss of Hb, hence the answer above.

3 0
3 years ago
Answer the question below pls
Veseljchak [2.6K]

Answer:

The answer would be at 120°C

6 0
3 years ago
Read 2 more answers
What volume of 12.0 M sulfuric acid is needed to prepare 300.0 mL of 2.50 M solution?
Zepler [3.9K]

Answer:

n=c*V

=2.50*300x10^-3

=.75 moles of hcl

v=n/c

=.75/12

=.0625 L

convert to mL

=62.5mL

4 0
3 years ago
Which element has 4 energy levels and 7 valence electrons
antoniya [11.8K]

Answer:

Beryllium 4 2

Boron 5 3

Carbon 6 4

Nitrogen 7 5

5 0
3 years ago
Which set of characteristics accurately describes the physical properties of electrons in atoms
zloy xaker [14]

Answer: Option (A) is the correct answer.

Explanation:

When there occurs no change in the chemical composition of a substance then it is known as physical property.

For example, mass, volume, density are all physical properties.

Since, the mass of an electron is negligible and an electron holds a negative charge.

Therefore, negatively charged particle with very little mass accurately describes the physical properties of electrons in atoms.

7 0
3 years ago
Other questions:
  • What is the wavelength in nm of a light whose first order bright band forms a
    9·1 answer
  • Malik formed a hypotheses that an increase in atmospheric oxygen levels by 10% would cause red-legged grasshoppers to grow large
    6·2 answers
  • A student has a mixture of solid sand and nacl(aq)in a flask to obtain solid nacl from this mixture the student should
    6·1 answer
  • Determine whether each carbohydrate is best described as a monosaccharide, a disaccharide, or a polysaccharide
    10·1 answer
  • How many moles of a gas will 700 m hold at -100 oC and 86 atm?
    6·1 answer
  • Which compound most likely has the greatest bond energy?
    15·2 answers
  • Compartments A and B are separated by a membrane that is permeable to K+ but not to Na+ or Cl-. At time zero, a solution of KCl
    9·1 answer
  • Which pair of elements is most likely to have similar properties?
    8·1 answer
  • If we had 79.3 grams of Xe, would we expect a volume that is
    5·1 answer
  • He density of water is 1 g/mL.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!