1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]3 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
A sample of helium gas has a volume of 620. Ml at a temp of 500 K. If we decrease the temperature to 100K while keeping the pres
Ne4ueva [31]

Answer:

A sample of helium gas has a volume of 620mL at a temperature of 500 K. If we ... to 100 K while keeping the pressure constant, what will the new volume be?

Explanation:

3 0
3 years ago
What can be absorbed or produced as the result of a chemical reaction???
tia_tia [17]
Heat can be absorbed or produced
6 0
3 years ago
Science is based primarily on peoples opinions and views of the subject matter.
kvv77 [185]

Answer:

False

Explanation:

Science is not based on primarily on peoples opinions and views of the subject matter whereas science is based on empirical observations and research for its validity.

<u>Science aims to find answers to human questions related to the natural world through their research observation and experiments. Scientists and researchers provide valid proof of human questions so that people can trust them.</u>

Science can change people's opinions regarding the natural world with valid proof and observational theories but science is not based on people's opinion.

Hence, the given statement is "false".

7 0
3 years ago
The amount of kinetic energy an object has depends on
Alex777 [14]
How much it has to drop and how heavy it is. Hope this is what you're looking for:)
3 0
3 years ago
Read 2 more answers
What are the three different types of selective breeding
balandron [24]

first of all there is only two types of selective breeding and they are hybridization and inbreeding.

3 0
3 years ago
Other questions:
  • What type of matter would vaporization and condensation fall under? Solid Liquid or gas?
    13·1 answer
  • If it takes 43.32ml of .1M NaOH to neutralize a 50ml HCL solution, how many moles of NaOH were added to the HCL solution?
    12·1 answer
  • Which of these best describes the difference between the formulas for nitrogen monoxide and nitrogen dioxide? Which of these bes
    9·1 answer
  • Which statement is true about the electrons that can be located together in an orbital?
    10·1 answer
  • True or false certain cations are associated with either exotermic or endothermic processes
    7·1 answer
  • Se ha añadido un evaporador para una alimentación de 11500 kg/dia de zumo de pomelo de forma que evapore 3000 kg/dia de agua por
    6·1 answer
  • What is the uncertainty for each of the following numbers? a) 65.74 b) 60.009 c) 66_ _d) 65.750
    5·1 answer
  • One mole of copper equals about how many atoms?
    14·2 answers
  • After 4 half-lives 10 grams of uranium remains. How much uranium did you start with?
    7·1 answer
  • Write any four limitations of a balanced chemical equation.​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!