1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
5

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

Chemistry
1 answer:
inysia [295]3 years ago
4 0

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

You might be interested in
Which objects cannot be observed in detail without a microscope?
Sonbull [250]

The objects which cannot be observed in detail without a microscope

include the following:

  • Red blood cell
  • Bacterium

<h3>What is a Microscope?</h3>

A microscope is an instrument which is used to view smaller objects such as

microbe,cells, tissues etc. This instrument is used in viewing the different

cells found in the body as they can't be seen with the eye.

The remaining options which can be seen with the eyes don't require

the use of microscopes.

Read more about Microscope here brainly.com/question/25268499

3 0
2 years ago
The water cycle imagine you are a rain drop
Soloha48 [4]
Evaporation,condensation,precipitation,sublimation,transpirtation,runoff and infiltration
7 0
3 years ago
How many grams of H, are needed to react with 2.75 g of N,?
Elena-2011 [213]

Answer:

0.6 grams of hydrogen are needed to react with 2.75 g of nitrogen.

Explanation:

When hydrogen and nitrogen react they form ammonia.

Chemical equation:

N₂ + 3H₂ → 2NH₃

Given mass of nitrogen = 2.75 g

Number of moles of nitrogen:

Number of moles = mass/ molar mass

Number of moles = 2.75 g / 28 g/mol

Number of moles = 0.098 mol

Now we will compare the moles of nitrogen with hydrogen from balance chemical equation:

                   N₂             :          H₂

                    1               :           3

                   0.098       :        3×0.098 = 0.3 mol

Mass of hydrogen:

Mass = number of moles × molar mass

Mass = 0.3 mol × 2 g/mol

Mass = 0.6 g

6 0
4 years ago
Which statement describes solctices
Firlakuza [10]

Answer:funk

hot dog cat

Explanation:

uhughuhuhuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu

8 0
3 years ago
Read 2 more answers
Come up with 2 examples of each law motion below: <br><br> 1st law:<br> 2nd law:<br> 3rd law:
Sloan [31]
1st law: Inertia, If you roll a ball it will not stop unless something blocks it by force.

2nd law: Force and Acceleration, when you’re riding a bike you are pushing the pedal with ur muscle which means you’re using force. Everytime you push the pedal the bike goes faster and faster which explains acceleration.

3rd law: Action and Reaction, If you run you’re feet pushes the ground (action) when your feet touches the ground it pushes you forward (reaction)
5 0
3 years ago
Other questions:
  • When heat energy is added two changes are observed: Change A: solid changes phases to a liquid Change B: liquid changes phases t
    8·2 answers
  • If you stirred some sugar in water the sugar would disappear but the water would taste sweet. This is because __________ change
    12·1 answer
  • IF SOMEONE HELP ME WITH THIS, I'll GIVE 100 POINTS! Create an organization structure for fictional elements. There are many ways
    6·1 answer
  • The symbol mm represents​
    13·2 answers
  • UuestoNS NIU
    15·1 answer
  • What are the correct coefficients (reading from left to right) when the chemical equation is balanced?
    13·1 answer
  • 2+2 because i really know im just trying something real quick
    15·2 answers
  • Which element is a metalloid?<br><br><br> Li<br><br> H<br><br><br> Ge<br><br> Ne
    7·1 answer
  • 11. What is deceleration also called?
    6·2 answers
  • A sample of 4.0 L of nitrogen, at 1.2 atmospheres, is transferred to a 12 L container.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!