Bedford a cell divides, it makes a copy of its genes during interphase
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The phase contrast microscope uses out-of-phase and in-phase light rays that produce contrast areas allowing scientists to detect even a minute number of protein molecules and focus on the minute internal structures of a particle.
<span>
</span>
Answer: when their is a new moon
Explanation:
Because they are not trained to
