1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks [24]
2 years ago
15

Hurry please

Biology
1 answer:
insens350 [35]2 years ago
4 0

Answer:

The answer would be A, and C.

Explanation:

I just know...MAybe,,?

You might be interested in
Which taxon contains only one kind of organism
ANTONII [103]

The the answer is Fungi

6 0
3 years ago
How can gel electrophoresis be used to help illegal poaching of great white sharks?
statuscvo [17]

Explanation:

Gel electrophoresis is one simple and cheap laboratory technique used in profiling. In this case, it can be used to identify Great White Sharks using their proteins or DNA. This way, even if the fish is completely mutilated into the meat, the species can still be identified helping policies to be enforced.

DNA or proteins of a sample of suspected meat is processed and passed through gel electrophoresis. The bands that form are then compared with a standard to check if the bands match. A match indicates that the meat is from a Great White Shark.

8 0
3 years ago
What system exchanges oxygen and carbon dioxide gases? (please answer soon)
abruzzese [7]
It is the repiratory and the circulatory
8 0
3 years ago
Read 2 more answers
What does the term "Trophic Cascade" mean?
V125BC [204]

Answer:

Trophic cascades are powerful indirect interactions that can control entire ecosystems. Trophic cascades occur when predators limit the density and/or behavior of their prey and thereby enhance survival of the next lower trophic level.

Explanation:

6 0
3 years ago
Read 2 more answers
what is defined as the movement of water across a semipermeable membrane from high concentration to low concentration?
Oliga [24]
<span>Osmosis is defined as the movement of water across a semipermeable membrane from high concentration to low concentration. This occurs when the surrounding environment of the cell has a higher water concentration than the cell itself. Osmosis is important in animal cells because it helps in the distribution of nutrients and the release of metabolic waste products. In plant cells, osmosis is responsible for the absorption of water from the soil and the elevation of the liquid into other parts of the plants.</span>
5 0
3 years ago
Other questions:
  • In 1980, lava that flowed from the eruption of Mount Saint Helens in the state of Washington destroyed the vegetation that once
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following describes mass
    12·1 answer
  • The division of the nervous system that includes the brain is the
    12·2 answers
  • Can you help me please??? Picture.....
    14·1 answer
  • Which cells are considered immortal?
    8·2 answers
  • How does rock turn to soil?
    5·1 answer
  • How does the cell membrane help the cell maintain homeostasis
    9·1 answer
  • Which of the following is a function of a carbohydrate?
    5·2 answers
  • Explain the quote: Biology is the most powerful technology ever created.?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!