1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvasek [131]
3 years ago
6

Diferencia entre materialismo y estructural funcionalismo.​

Law
1 answer:
Alex787 [66]3 years ago
8 0

Answer:

El materialismo es la posición de que todo es físico, por lo que la mente también debe ser física. No hay alma o fantasma en la máquina con la que no podamos interactuar u observar; el cerebro y el cuerpo es todo lo que tenemos.

El funcionalismo es la posición de que los estados mentales deben definirse no por cómo se implementan, sino por su función dentro del sistema en el que se encuentran. Entonces, el dolor puede ser el estado que está presente durante una lesión corporal, hace que un agente retroceda ante los estímulos lesivos, hace que el agente desee evitar esos estímulos en el futuro, etc., etc. Para el funcionalista, no importa si este estado se implementa dentro de neuronas o silicio. De cualquier manera, es doloroso.

Con respecto a la relación entre materialismo y funcionalismo, muchos funcionalistas son materialistas (o fisicalistas), pero no hay nada inherente al funcionalismo que obligue a sus seguidores a ser materialistas.

You might be interested in
Managing office politics falls under the main HR manager responsibility of.....?​
madam [21]

The correct option is D. Managing office politics falls under the main HR manager's responsibility of employee advocacy.

Office politics can be stopped from becoming toxic through human resources. In actuality, HR is ideally suited to promote a joyful and effective workplace. The impact of office politics should be kept to a minimum.

<h3>How does workplace politics occur in an organization?</h3>

Office politics develops when staff members abuse their authority to attract unwarranted attention and popularity at work. Employees engage in office politics just to harm the reputation of a colleague in order to get advantages and win favor with their superiors.

The complicated social structure of a workplace is referred to as office politics. It involves employees pursuing their own objectives by abusing their positions of authority, influence, and delegation. Everyone has a unique job to play within the microcosm of any business.

Learn more about HR manager responsibility here:

brainly.com/question/25806768

#SPJ1

6 0
2 years ago
Read 2 more answers
BACK TO SCHOOL<br> Assalamualaikum wahromatulohi wabarokartu
zalisa [80]

Woww congratulations.I am missing my school days and friends very much....

4 0
3 years ago
When following a large vehicle, maintain a following distance of 4 or more seconds. a. true b. false
Sonbull [250]

The Above Statement is True and Rigid.

When visibility is low such as light fog, light rain, or nighttime driving, you should double the following distance to a minimum of 4 seconds. This will seem like a large gap between you and the vehicle in front of you.

<h3><u>What is the 4-second following distance rule?</u></h3>
  • The four-second rule in driving means you should remain at least four seconds behind the vehicle in front of you. This way, if you have to abruptly stop, there's a better chance of avoiding a collision.
  • It's especially important to apply the four-second rule when driving on or in: Slippery, wet, or icy roads
  • The space between your vehicle and a large vehicle behind you on a highway should be four seconds at speeds of 46-70 mph, plus one second for every 10 feet of vehicle length

To learn more about road safety rules, click the links.

brainly.com/question/3902437

#SPJ4

Correct Question - If you are traveling at highway speeds and are just 3 seconds back, your following distance may not give you enough room to make an emergency stop if the vehicle ahead of you crashes. Therefore, when driving at highway speeds, plan to follow back 4 or more seconds to give you more time to stop your vehicle in emergency stopping situations.

a. True

b. False

3 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Which of the following reasons best explains why Mistress Owens wants to adopt the mysterious baby?
Svetach [21]

Answer:

Mr. and Mrs. Owens adopt Bod because they were never able to have children of their own

Explanation:

It is in the passage if you read it closely.

8 0
2 years ago
Other questions:
  • Barbie committed a felony and has to appear in court.
    11·2 answers
  • What is parole? Who makes the decisions about parole?
    13·1 answer
  • I dont know what 2 plus 2 is
    8·2 answers
  • Why so many people say that trump is starting a purge outta no where ?is this statement true or false? EXPLAIN!!
    12·1 answer
  • What are two cabinet level positions? (2 points) pick 2
    12·1 answer
  • On Election Day, which Poll Worker position is responsible for the setup and breakdown of the EViD?
    12·2 answers
  • What states can I legally own a pet bat?
    9·2 answers
  • 5. Police became aware of the crawl space because of a
    8·1 answer
  • 4. Imagine you are an investigator who has brought in a potential suspect in a murder investigation. the suspect is 30 years old
    5·1 answer
  • What is the texas constitutional amendment special election
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!