1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
6

What fossils of organisms delicate parts?

Biology
1 answer:
Anna35 [415]3 years ago
4 0

Answer:

I think that the fossil is a carbon fossil

Explanation:

They preserve life in fine detail, including the soft tissue of plants and animals.

You might be interested in
Why are the EPA's water quality standards useful?
professor190 [17]
It can help determine the quelity and safety of water. This can be a good deciding factor of choosing between tap vs bottled water. If the rating is too bad you should choose to use bottled water
4 0
3 years ago
Which kind of investigations are meant to provide large amounts of info about a wide range of variables
IrinaK [193]

Answer:

Experimental

Explanation:

7 0
3 years ago
Read 2 more answers
Plants can break large rocks into tiny pieces. How is it possible for plants to be able to mechanically weather rocks by breakin
lidiya [134]

Answer:

The roots of the plant grow into the cracks of the rock forcing the rock to break.

Explanation:

Hope this helps

6 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
An organism that has the same genes as the organism from which it was produced is called
Romashka-Z-Leto [24]

The answer is a clone.



5 0
3 years ago
Other questions:
  • What are molecules that are both attracted to water and repel water called?
    13·2 answers
  • The ____ diet has been linked to lower risk for metabolic syndrome and stroke, improved brain health and cognitive function, and
    7·1 answer
  • Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell
    14·2 answers
  • Is a enzyme and protein the same thing or different
    11·1 answer
  • Which of the following is expected to occur if a keystone species is removed fram an ecosystem?
    5·2 answers
  • What is Natural selection
    15·1 answer
  • Water vapor will return to Earth in about 10 days t/f
    10·1 answer
  • Write this number showing three significant figures. Remember to round.
    6·1 answer
  • Hello please give answers
    11·2 answers
  • Describe how communities have conserved and protected forest and wildlife in india.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!