1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serjik [45]
3 years ago
8

True or False a Carnivore can never be the first animal in a food chain

Biology
1 answer:
irina [24]3 years ago
6 0

Answer:

False

Explanation:

Carnivores can never be the first animal in a food chain because food chains start with plants and animals that eat plants are either herbivores or omnivores. So the answer is false.

You might be interested in
Use the model here to describe the transfer of matter and flow of energy from one trophic level to another within an ecosystem.
Andrews [41]

The food chain and food web are used to transfer energy. Plants, who are the primary energy providers in the ecosystem, use their chloroplasts to collect sunlight, which is then partially converted into chemical energy during photosynthesis.

a)

  • When herbivores eat (are the primary consumers of) plants as food, this energy is transferred to the primary consumers in the food chain.
  • This energy is stored in various organic products in plants. Then, the chemical energy contained in plant products is converted into kinetic energy, degrading the energy by turning it into heat. The secondary consumers come next.
  • Further deterioration will occur when these herbivores are consumed by secondary consumers.
  • Finally, energy will once more be destroyed when tertiary consumers eat the carnivores. As a result, the energy flow is only in one direction i.e., unidirectional.

b)

  • Additionally, the energy flow in a food chain adheres to the 10% law.
  • This law states that only 10% of energy is transferred from one trophic level to the next, with the remaining 90% being lost during the digestion process of the organism itself.

c)

  • There are typically fewer organisms at the top of an energy pyramid because It has the least quantity of energy, the top level of an energy pyramid has the fewest organisms.
  • Most ecosystems only have four trophic levels because there is eventually insufficient energy to maintain further trophic levels.

d)

  • For instance, let us assume that a plant at the producer level produces 1000 Kcal of energy.
  • When a primary producer eats this plant, it will only get 10% of the energy produced by the plant i.e., 1000/10 = 100 Kcal. the rest 90% will be used up by the plant itself for its metabolism.
  • Further when a secondary consumer eats the primary consumer, it will only get 10% of the energy produced by the plant i.e., 100/10 = 10 Kcal.
  • Lastly, as the tertiary consumer eats the secondary consumer, it will only get 10/10 = 1kcal.

learn more about ecosystem here: brainly.com/question/842527

#SPJ10

4 0
2 years ago
What is the immediate effect of condensation of water vapor?
Pachacha [2.7K]
Formation of clouds containing water droplets


Hope this help
4 0
3 years ago
Smell and taste are the two senses that are stimulated by chemicals.
svp [43]
The best answer is true.
3 0
3 years ago
Read 2 more answers
Animals conduct certain behaviors in mating. Some practice _____, in which one male breeds with only one female, and others prac
Artemon [7]
I believe that it's this
1st blank : monogamy.
Reason: I believe that it's monogamy because it's when someone/something is has one mate. Also, monogamy is the one with the closest definition as stated is the question.

2nd blank : polygyny
Reason: The answer to this one may be polygyny because it is when someone/something has more than one female mate (like in your question).

Hope this helps. Disclaimer:I'm not sure if it's right though :)
4 0
3 years ago
Read 2 more answers
In Mediterranean climate regions like portions of California, a wetter-than-normal winter often leads to greater severity of fir
11Alexandr11 [23.1K]

Answer:

A.  Greater accumulation of chapparal biomass...

Explanation:

Due to more wet conditions, the precipitation of that specific area remains higher than normal for a slightly long period increased parallel to the amount of precipitation. Due to this time slippage, algae, fungi and other biomass enhancing organism flourish very easily. They were dormant in normal winter but the slight time increase increases the biomass to a greater extend as you think. That make the fires to become more severe because of presence of mere organic biomass...

4 0
3 years ago
Other questions:
  • Which of the following usually has the most adverse effect on an individual?
    15·2 answers
  • The substrate for lactic acid formation is what?
    13·1 answer
  • Can somebody explain to me photosynthesis as simple as possible please :)
    11·2 answers
  • 1. What does it mean to say particles move from high concentration to low ?
    15·1 answer
  • What must differ between the atom of two different elements
    11·2 answers
  • Mya is running a marathon. Her heartbeat increases. How does the increase in heartbeats assist Mya’s respiratory system? The inc
    11·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Trade winds blow from the horse latitudes toward the______.
    10·1 answer
  • Can someone answer this please?
    10·2 answers
  • Models are useful when studying multicellular organisms because
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!