1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
1 year ago
5

What is the forward movement of materials along the length of the digestive tract called?

Biology
1 answer:
serious [3.7K]1 year ago
3 0

Food is moved through the digestive tract by a sequence of wave-like muscle contractions called peristalsis.

<h3>What is digestive tract?</h3>
  • The digestive system of the human body is made up of the gastrointestinal tract and additional digestive organs (the tongue, salivary glands, pancreas, liver, and gallbladder).
  • In order for food to be absorbed and incorporated into the body, it must first be broken down into smaller and smaller components during digestion.
  • Cephalic, gastric, and intestine phases make up the three stages of the digestive process.
  • Gastric gland secretions in reaction to the sight and smell of food start the initial stage of digestion, known as the cephalic phase.
<h3>What is peristalsis?</h3>
  • Peristalsis is the contraction of the muscles. is the contraction and relaxation of radially symmetric muscles that travels anterogradely down a tube in the form of a wave.
  • In the lining of the gut, a simultaneous contraction of the longitudinal muscle and relaxation of the circular muscle is followed by a coordinated contraction of involuntary circular muscles known as peristalsis.

Learn more about peristalsis here:

brainly.com/question/15265456

#SPJ4

You might be interested in
Which earth system is responsible for wind?
n200080 [17]

Answer:

convection within the atmosphere

3 0
2 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Jealous can spark? <br><br> all of the above<br> passion<br> worry<br> excitement
goblinko [34]

Answer:

All of the above.

Explanation:

Jealousy is the emotional state of feeling jealous. This is more of a negative aspect rather than a positive one, but can also sometimes be a positive aspect in a relationship.

Jealousy incites the person to have negative feelings like anxiousness, wrath, anger, possessiveness, excitement, etc. But it can also lead to an increase in the passionate feelings for the other person, which can make the individual pay more attention to the other person. In this aspect, it becomes a positive thing.

Thus, the correct answer is all of the above.

5 0
3 years ago
PLZZZZZZ HELP, THANKS!
andrey2020 [161]
A
he cross bred them and learned about recessive and dominate traits
5 0
3 years ago
The largest organic molecules are:<br> A.nucleic acid<br> B.carbohydrates<br> C.fats<br> D.proteins
xenn [34]
Your answer is B. carbohydrates. hope this helps
8 0
2 years ago
Read 2 more answers
Other questions:
  • I will give brainliest to best answer!
    15·1 answer
  • A professor is teaching a class anatomy and physiology and mentions that closure of the airway occurs at anatomically different
    5·1 answer
  • Which image most likely represents muscle structure?
    11·1 answer
  • The space between the iris and the cormea is the
    14·2 answers
  • What does Darwin's theory of evolution explain<br> about the natural world?
    9·1 answer
  • In what vessel is blood pressure the highest? the lowest? in what vessel is blood flow rate the fastest? the slowest?
    5·1 answer
  • Which plant belongs to the cabbage family?​
    6·1 answer
  • List the phases of mitosis and what happens during each phase.
    14·1 answer
  • The organization of a organism from smallest to largest is Cell, tissue, organ, organ system, organism
    9·1 answer
  • Savannah wraps some gifts and then brings them to the post office where they are delivered to people in different parts of the c
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!