<span>There is a remote possibility a barren rock could turn into a temperate forest, but this would have taken billions of years. It is not likely to have happened therefore I would have to say the answer is false.</span>
Answer:
Hattie has a calculus in her ureter, or kidney stone. Frequent urinary tract bacterial infections, urinary retention, high levels of calcium in the blood, and alkaline urine are predisposing conditions. Her pain comes in waves when peristalsis waves travel at intervals through the ureter. The pain comes when the ureter walls close in during this period on the hard kidney stone
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
Answer:
4: B. lactic acid + ATP
5: carried out by cells, such as our muscle cells.
Explanation:
hope this helps!!
Conocybe Filaris
Podostroma Cornu-damae
Hope it helps! :)
