1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
12

Plz help if you can added photo.

Biology
1 answer:
Agata [3.3K]3 years ago
8 0

Answer:

i think they are asking for how many electrons so maybe 2 or 1s^2

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
A student places 5 seeds on a wet paper towel and then places that in a completely sealed jar. The mass of the sealed jar is mea
Rom4ik [11]

Answer: b

Explanation:

7 0
3 years ago
Read 2 more answers
The ocean contains vast amounts of salts and other minerals. For example, 1 cubic kilometer of ocean water contains about 5,000
valina [46]

Answer:

The ocean is rich.

Explanation:

4 0
3 years ago
Which factors affect the rate of photosynthesis? Select all that apply. A).light intensity B).pH C).temperature D).chlorophyll d
sashaice [31]

Answer:

C.)

Explanation:

4 0
3 years ago
Read 2 more answers
A student isolates a protein from anaerobic bacteria and analyses the protein by polyacrylamide gel electrophoresis containing S
elixir [45]

Answer:

The correct answer is option D.

Explanation:

In the presence of SDS single band appeared, while in the absence of SDS two bands appeared. SDS or sodium dodecyl sulfate refers to an anionic detergent, which combines with amino acid side chains providing the protein a net negative charge. It dissociates the non-covalent bonds.  

In SDS-PAGE, the separation of proteins takes place on the basis of their molecular weight. Options A and B are incorrect as only in the presence of SDS, the separation of protein subunits takes place. Option C is also incorrect as a protein containing distinct molecular weight cannot show single band.  

Option D is correct as the presence of SDS supplements a bunch of negative charges to the protein, thus, charge is not the factor. Therefore, the proteins are distinguished on the basis of the molecular weight. Thus, identical molecular weight demonstrates a single band. In the non-presence of SDS, charge performs a function along with the molecular weight, therefore, two bands appear.  

8 0
3 years ago
Other questions:
  • Which of the following are included in the binomial name given to an organism? End of exam A. Genus, species B. Species, family
    13·1 answer
  • when an infection occurs, the number of a. red blood cells increase b. red blood cells decrease c. white blood cells increase d.
    14·2 answers
  • A shipping company employee notices that the inside of ships' hulls where ballast water is stored are deteriorating. The hull pa
    5·1 answer
  • During transcription the DNA base sequence is transcribed into a complementary mRNA sequence. A codon table like the one shown b
    13·1 answer
  • The process by which organisms that are better adapted to the environment survive and reproduce is called ?
    5·2 answers
  • Plzzzz help which of the following are correct about DNA fingerprinting
    6·2 answers
  • Who was an American that was able to significantly improve the quality of the magnified images with his microscopes?
    12·2 answers
  • EXPLAIN WHY CELL DIVISION IS AN IMPORTANT PROCESS FOR MULTICELLULAR ORGANISMS.
    14·1 answer
  • Penguins, which are birds, and seals, which are mammals, do not share a common ancestors, but both have flippers adapted for swi
    10·1 answer
  • Describe why food needs to be digested from large to small molecules.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!