1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
2 years ago
6

Connective tissue is made of which three essential components?

Biology
1 answer:
grandymaker [24]2 years ago
7 0

Answer:

Cells, protein fibers, and an amorphous ground substance

Explanation:

Connective tissue provides support, binds together, and protects tissues and organs of the body. Connective tissue consists of three main components: cells, protein fibers, and an amorphous ground substance. Together the fibers and ground substance make up the extracellular matrix.

You might be interested in
What is different between gas giants and terrestrial planets in our solar system
Allushta [10]

Answer: Gas giants are larger, have more moons, and are less dense. They also are outer planets. Terrestrial planets are more dense, have a rocky and hard surface, and less moons sometimes no moons. They are called the inner planets.

7 0
3 years ago
How did you save Clark?
Mkey [24]
Huh?????????????????
7 0
3 years ago
How many chromosomes does a human body have?
Novay_Z [31]
<span>Humans have 23 Chromosomes </span>
8 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Identify the type of growth response that each plant demonstrates.
aleksley [76]

Answer:

The first plant demonstrate stunt growth. The second one demonstrate rapid growth

Explanation:

The first one lacks proper care and is not exposed to sunlight. The second one is the opposite of the first one

3 0
3 years ago
Other questions:
  • How is the normal chromosome number for humans is maintained from one generation to the next?
    6·1 answer
  • 1. In a certain plant population, yellow seed color is recessive to green seed color. If a yellow seeded plant is crossed with a
    13·1 answer
  • BRAINLIEST ANSWER!!!!!!
    15·2 answers
  • Total human population growth has continued to increase in recent years, but some countries around the globe are actually decrea
    9·1 answer
  • What is the outer boundary of an animal cell called?
    7·2 answers
  • What helps determine a
    8·2 answers
  • Which of the following factors may contribute to a population maintaining Hardy-Weinberg equilibrium
    9·2 answers
  • What is the relationship between changing CO2 emissions and CO2 concentration?
    7·1 answer
  • I need help!<br><br> What significance does density have for earth?
    11·1 answer
  • What is the main purpose of WBC in blood platelets​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!