1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BARSIC [14]
3 years ago
7

5’ 3’

Biology
2 answers:
Gre4nikov [31]3 years ago
8 0

Answer:

hmmm????? good question

Explanation:

Morgarella [4.7K]3 years ago
7 0
it would be the sam because it’s being replicated
You might be interested in
Which describes sexual reproduction and not sexual reproduction?
Vesnalui [34]

Answer:

Sexual Reproduction are creatures using things like their genitals for reproduction

Asexual Reproduction are things like for example, Hydras, which are a real creature, a part of them falls off, and it grows into its own separate thing

6 0
3 years ago
Read 2 more answers
Describe a tropical rainforest?
makkiz [27]

Answer:

The tropical rainforest is a hot moist biome where it rains every day year month etc, There is only a small amount of sunlight and rainfall that these plants receive. They usually adapt to their home environments! :)

Explanation:

3 0
3 years ago
Photosynthesis and cellular
wlad13 [49]

Answer:

cellular respiration and photosynthesis work together by taking in energy such as the sun, or Co2 to convert that into energy and oxygen right back into the atmosphere.

Explanation:

6 0
3 years ago
A man with type AB blood marries a woman with type A blood. What are the possible blood types of their offspring if the woman's
yuradex [85]

i think the answer would be a, b, ab

7 0
3 years ago
Ecosystems with greater biodiversity have an increased stability. Please select the best answer from the choices provided T F.
denis23 [38]

Answer:

T

Explanation:

Greater biodiversity in ecosystems, species, and individuals leads to greater stability. For example, species with high genetic diversity and many populations that are adapted to a wide variety of conditions are more likely to be able to weather disturbances, disease, and climate change

8 0
2 years ago
Read 2 more answers
Other questions:
  • Which sentence best represents the process through evolution occurs?
    6·2 answers
  • Who is generally given credit for the modern concept of the double stranded dna helix
    10·1 answer
  • The traits for blood type and Rh are the result of the presence or absence of particular (PROTEINS) or (ENZYMES) on the erythroc
    12·1 answer
  • Summarize microevolution and macroevolution and describe the diiferce between the two
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A ___________________ is a multicellular haploid form and a ____________________ is a multicellular diploid form in a plant that
    11·1 answer
  • Which word of the poem are an example of a simile
    6·2 answers
  • The pituitary gland is the bodys master gland true false
    13·2 answers
  • What Emma pushes a bag with a force of 27 Newton's the coefficient of Connecticut friction between the bag and the floor is 0.23
    14·1 answer
  • Which term names part of the peripheral nervous system?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!