1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goryan [66]
3 years ago
5

Why am I l ugly Pls don’t report and I am gonna delete it soon anyways

Biology
2 answers:
Lostsunrise [7]3 years ago
6 0

Answer:

ur not ugly God made you, and if you love yourself that is all that matters and whoever thinks ur ugly is ugly and u r not ugly trust me have a blessed day sweetie

Karo-lina-s [1.5K]3 years ago
4 0

Answer:

You are not ugly.

Today's society forces you to believe you're ugly based off of your place in society it's true some don't win the genetic lottery but what I see here is a perfectly good untainted human being. There's nothing wrong with you friend. This longneck guy on social media for example. He was not so lucky in the genetic lottery and has Marfan syndrome explaining his weirdly long arms and legs. That is not a perfectly good human being however with you I see nothing wrong. Have a great day!

You might be interested in
What type of cross produces a 1:1:1:1 phenotypic ratio?
ser-zykov [4K]
Cross between "Homozygous Dominant" & "Homozygous recessive" would result in offspring of phenotype 1:1:1:1. When linkage is not occurs!

Hope this helps! It's quite complicated. So, Pm me in case of doubt!
Happy Studying :)
6 0
3 years ago
What percentage of ozone is contained in the stratosphere? a. 10% b. 50% C. 80% d. 90% Please select the best answer from the ch
liraira [26]

Answer:

About 90% of the ozone in our atmosphere is contained in the stratosphere

Explanation:

3 0
3 years ago
An example of carbon 3 plant is<br>A, Rice<br>B, Maize,<br>C, Millet<br>D, Barley​
Svetlanka [38]

Answer:

the correct answer is Rice

8 0
3 years ago
Read 2 more answers
By the 1900s what type of evidence was being collected at crime scenes to help positively identify suspects by one particularly
guapka [62]

Answer:

By 1900, Fingerprint was the evidence which was collected at crime scenes to help positively identify suspects by one particularly unique trait.  No two people can have the same type of fingerprints. It is a unique characteristic which is even not common among identical twins. Therefore, was considered as an important evidence for identification of suspects and linking them with the scene of offence. In 1904, the city of St.Louis, Missouri used fingerprint evidence for the first time for criminal identification.

7 0
3 years ago
Question 1 of 20 : Select the best answer for the question. 1. Suppose a population is carrying a condition controlled by two al
lianna [129]
Genotype frequency: RR is dominant, Rr is heterozygous and rr is recessive.

R^2+2Rr+r^2 = 1

R = 0.85

R^2= 0.85*0.85 = 0.7225
7 0
3 years ago
Other questions:
  • Sebaceous secretions associated with hair follicles that secrete an oily, odorous, messy secretion are due to what type of secre
    14·1 answer
  • I used a lot of different pieces of equipment, I liked to use the DNA analyzer the most. Forensic science has changed drasticall
    14·1 answer
  • While the average human is able to hold his or her breath for approximately one minute, a whale can dive for over 30 minutes wit
    14·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The cellulose in plants helps them to stand up straight against gravity and wind. What type of
    8·1 answer
  • The _____ is a layer of the embryo, which will become the circulatory system, bones, muscles, excretory system, and reproductive
    10·2 answers
  • During which part of the cell cycle is the duplicated genetic material within the nucleus of a parent cell separated to create t
    9·2 answers
  • Which of the following is a way humans use trees? a. paper b. food c. wood d. all of the above
    7·2 answers
  • Moles and freckles are similar in that they are both:
    6·2 answers
  • If a mother is a carrier of the recessive gene (Xx) for hemophilia and
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!