1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
2 years ago
8

Why can king snakes eat rattlesnakes ?

Biology
1 answer:
dolphi86 [110]2 years ago
5 0
Kingsnakes squeeze their prey to death, are immune to rattlesnake venom and are so named for their astonishing ability to overpower and eat snakes that are much larger than they are.
You might be interested in
suppose you found a bone of a mastodon which had 6.25%c14and93.75%n14 how long ago did this animal die​
lisabon 2012 [21]

Answer:

t= 3886.18 years old

Explanation:

Whenever an animal dies de C14 and N14 begin to disintegrate in such a way that the proportion between C14 and C12 decreases, with a semi-disintegration period of 5.730 years, T. To get to know how long it takes an element to disintegrate, we must use this semi-disintegration period, which is the time it takes until the amount of the element is reduced to its half.  

We can find the age of the fossil, t, by using the next formula:

t = - (T x ln (C14))/ ln (2)

t = - (5730 x ln (0.625)/0.693

t= - (-2693.12)/0.693

t= 3886.18  

3 0
3 years ago
What is it called when two forms of a trait are both dominant at the same time?
vodomira [7]

Answer:

Codominance

Explanation:

3 0
3 years ago
Read 2 more answers
What do the molecules in a solid object do
jonny [76]
The molecules in a solid object are packed together, meaning that they are closely together and can’t move freely
6 0
3 years ago
If a human has an X and a Y chromosome pair, they are
algol13
With this x and y pair they are male
6 0
3 years ago
The diagram provided shows the carbon and nitrogen flow through a man-made mussel bed in the ocean. What evidence would support
yKpoI14uk [10]

Answer:

c

Explanation:

3 0
3 years ago
Other questions:
  • Are there blood vessels in the cornea
    13·2 answers
  • How do the biomes change as you go from west to east across the United states?
    5·1 answer
  • Which of the following pathogens typically causes infections on the surface of the skin and nails, such as athlete's foot?
    8·2 answers
  • Why does the cell go through elaborate process to convert glucose into carbon dioxide and water?
    5·1 answer
  • Discuss the biological underpinnings of motivation including needs drives and homeostasis.
    5·1 answer
  • Which of the following best explains a characteristic that differentiates fungi from animals?
    11·2 answers
  • Select the correct answer.
    10·1 answer
  • What's the word equation for photosynthesis​
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Over 30 children younger than three years of age developed gastroenteritis after visiting a local water park. These cases repres
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!