Oxygen crosses the cell membrane by

Biology

1 answer:

Dimas [21]2 years ago

3 0

Answer:

diffusion

Water, carbon dioxide, and oxygen are among the few simple molecules that can cross the cell membrane by diffusion (or a type of diffusion known as osmosis ).

Explanation:

You might be interested in

Question 1 (2 points)

ch4aika [34]

Answer:genetic drift

Explanation:

3 0

3 years ago

Can i get some help with this question

Dimas [21]

Answer:

photograph cells in mitosis

5 0

2 years ago

Read 2 more answers

PLEASE HELPPPPP!!!!! The law of conservation of mass states that the mass of all the substances present before a chemical change

White raven [17]

Answer:

Use the vingear and baking soda experiment but change it to lemon and not vingear.

Explanation:

A chemical reaction takes place when vinegar and baking soda are mixed. One of the new substances formed is carbon dioxide gas. If the carbon dioxide gas is contained, the mass of the substances will stay the same according to the Law of Conservation of Mass. If the gas is allowed to escape, the mass will be less

6 0

2 years ago

Which of the following would a Romanticism author most likely write about?

Stella [2.4K]

<span> Romanticism author usually are famous for the picture they sketch with their words about nature and beauty
so He would like to write about the
</span><span>the beauty of a weeping willow
</span>so i conclude option C is correct
hope it helps

6 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago