1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
14

PLEASE HELP WITH BOTH I WOULD APPRECIATE IT SO SO SO MUCH❤️

Mathematics
1 answer:
S_A_V [24]3 years ago
7 0

Answer:

The answer to question 14 is (6, 5), and the answer to question 15 is D) x = -2 and y = 1.

Step-by-step explanation:

Question 14 explanation: Because each line on the graph represents a different function, that means that the point where they intersect is the answer, as the point both appear on the equations y = \frac{1}{2} x+2 and y=x-1. Since the two equations' point of intersection is (6, 5), that means the solution to the system of equations is the point (6, 5).

Question 15 explanation: The solution to the system of equations 3x+4y=-2 and 2x-4y=-8 would be the x and y values that satisfy both equations. If you select the pair on selection D, you'll find that it's valid. 3(-2)+4(1)=-2 ⇒ -6+4=-2 ⇒ -2 = -2, which is true, so choice D works for the first equation. 2(-2)-4(1)=-8 ⇒ -4-4=-8 ⇒ -8=-8, which is also true. This means that x = -2 and y = 1 is the solution to the system of equations, making choice D the correct answer.

You might be interested in
Name the intersection of lines M and T
noname [10]

i need a picture if im going to help

3 0
3 years ago
What fraction of her team's total points did Cynthia score?
Nataly_w [17]

Answer: 5/6

Step-by-step explanation:

because if you get velocity and multiply it by the term which is 5/12 you half the denominator.

7 0
3 years ago
How do i solve these? i have no idea
Elanso [62]

Answer:

you multiply side by side by side

<em><u>Happy Valentine's Day My Love!!!<3<3</u></em>

Step-by-step explanation:

8 0
3 years ago
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
3 years ago
Find the x and y-intercepts of each question. -3x + y = 6
enyata [817]
X-intercept = -2
y-intercep = 6
8 0
3 years ago
Read 2 more answers
Other questions:
  • 3. Ken solved the linear equation 2(5y - 1) = 18 using the following steps.
    12·2 answers
  • Jenna has a bag that contains 7 red marbles and 25 blue marbles. She selects a marble at random, and then, without replacing the
    9·2 answers
  • The bricks Mr. Johnson used to make his patio are shaped like regular octagons. Which
    14·2 answers
  • Double the sum of a number and three is the same as the number subtracted by nine
    10·1 answer
  • What is the volume of the rectangular prism?
    9·1 answer
  • Complete the table below for the function y = -3x+7
    13·1 answer
  • Can someone help me pls? I don't understand how to find x and y
    14·1 answer
  • a candy bar box is in the shape of a triangular prism. The volume of the box is 1200 cubic centimetres. The base is 10 centimetr
    10·1 answer
  • Evaluate the expression if a = 2, b = −3, c = −4, h = 6, y = 4, and z = −1. <br><br><br> |2b−3y||+5z
    11·1 answer
  • Shape B is an enlargement of shape A by scale factor -2.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!