1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
10

Describe the three main properties that scientists measure when they study populations

Biology
1 answer:
mars1129 [50]3 years ago
8 0
Size, density, and growth rate are the three main ones. There is also dispersion, age structure, and survivorship. Hope this helps!
You might be interested in
5. What is true about energy transfer in communities?
Nadya [2.5K]

Answer:

D

Explanation:

5 0
2 years ago
Archaea are often called _________ because they live in areas where most living things couldn't survive.
Licemer1 [7]

Answer:

B. extremophiles

Explanation:

Archaea are often called <u>extremophiles</u> because they live in areas where most living things couldn't survive.

5 0
3 years ago
Read 2 more answers
Which statement about infiltration is TRUE? Group of answer choices groundwater is an unsafe (dangerous) source of water not mea
weeeeeb [17]

Answer: Groundwater can remain in subsurface storage for long periods of time.

Explanation:

The ground water is the water reservoir that gets accumulated beneath the earth crust due to the accumulation of water that seeps into the soil and rock due to the absorption by water bodies river, lakes, ponds, oceans, and rain or any kind of precipitation. The groundwater remains as a subsurface storage of water until the site of groundwater is searched and water is extracted from it for household, agricultural or industrial purposes.

8 0
3 years ago
MUST BE at least 350 WORDS 50 POINTS
Alona [7]

Answer:

Sickle cell disease (SCD) affects millions of people around the globe and is the 4th leading cause of deaths in children in many developing countries. It causes a number of health problems, such as attacks of pain, anaemia, swelling in the hands and feet, bacterial infections and stroke. Sickle-cell contributes to a low life expectancy in the developed world of 40 to 60 years.  

The disease results in abnormal haemoglobin - the oxygen-carrying protein found in red blood cells – giving the blood cell a rigid, sticky, sickle-like shape that hinders its oxygen-binding properties. These irregularly shaped cells can get stuck in small blood vessels, which can slow or block blood flow and oxygen to parts of the body. A blood and bone marrow transplant is currently the only cure for sickle cell disease, but only a small number of patients are eligible. For the rest, there's no cure but effective treatments can relieve pain, help prevent problems associated with the disease and prolong life.

70 years ago, researchers found a genetic connection to the anatomical abnormalities seen in blood cells. A mutation seemed to be causing the moon-shaped blood cells. The most severe form of the disease occurs when two copies of the mutation are inherited. However, patients with one sickle cell gene, referred to as sickle cell trait, usually do not have any of the signs of the disease and live a normal life, but they can pass the trait on to their children.

As with all inherited genetic diseases, you’d expect natural selection to weed out a gene that has such unpleasant consequences but with sickle cell disease, that doesn’t seem to be the case. Indeed, as of 2015, about 4.4 million people have sickle cell disease, while an additional 43 million have sickle cell trait. So what makes the disease stay in the human population?

Researchers found the answer by looking at where the disease was most prevalent. As it turns out, 80% of sickle cell disease cases occur in Sub-Saharan Africa or amongst populations having their ancestors in this region, as well as in other parts of the world where malaria is or was common. There was a long standing theory that the sickle cell trait – having only one sickle cell gene – didn’t cause discomfort and provided a bonus trait of preventing patients from contracting severe forms of malaria. Later confirmed - associating sickle cell to a 29% reduction in malaria incidence - this working theory would explain why the mutation stuck around in evolution. In 2011, researchers used mice to confirm the assumption.

Miguel Soares and Ana Ferreira of the Gulbenkian Institute of Science in Oeiras, Portugal, and colleagues found that haem – a component of haemoglobin – is present in a free form in the blood of mice with sickle cell trait, but largely absent from normal mice. By injecting haem into the blood of normal mice before infecting them with malaria, researchers found it could help guard against malaria. The mice did not develop the disease. Their results also showed that the gene does not protect against infection by the malaria parasite, but prevents the disease taking hold after the animal has been infected.

Explanation:

Sorry if I did or got anything wrong:(

I actually tried on this tho:)

3 0
3 years ago
What property of water gives it a strong surface tension
Bas_tet [7]

Answer:

cohesion

Explanation:

5 0
3 years ago
Other questions:
  • Which of the following does NOT affect earth’s season
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How did the occurrences of the different traits change over the 30-year period? Use evidence from the graph to support your answ
    12·2 answers
  • ILL MARK BRAINLIEST
    10·2 answers
  • It is always important to note possible sources of error in the conclusion.
    12·2 answers
  • Specific proteins produced in a cell are directly related to the A. Number of mitochondria in the cell. B. Sequence of sugars an
    11·1 answer
  • Which of the following is NOT true of the grass in the pasture story
    6·1 answer
  • What happens to mRNA after transcription ?
    12·2 answers
  • Considering the lungs are spongy tissue with air sacs, why would a difference in pressure cause the lungs to rupture? What is as
    15·1 answer
  • What will happen to the cell as it reaches equilibrium?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!