1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
3 years ago
9

Short-term mechanisms for regulating blood pressure include regulating peripheral vascular resistance and cardiac output through

:________-
Biology
1 answer:
Gekata [30.6K]3 years ago
3 0

Answer:

Dilation or constriction

Explanation:

Short-Term mechanism for regulating blood pressure include regulating peripheral vascular resistance and cardiac output through dilation or constriction of the blood vessels while on the other hand, long-term mechanism for controlling of blood pressure done by the renin-angiotensin system. Brains stem is the part of the brain that is responsible for the controlling of blood pressure in the body.

You might be interested in
HEEEEEELP. PLEASEEEEEEEEEEEEE
8_murik_8 [283]

there you go ^^

hope i helped

Download pdf
6 0
3 years ago
The last caribbean monk seal that died was the last memeber of what
mars1129 [50]

Texas coast in 1926 and 1932. The last seal recorded to be killed by humans was killed on the Pedro Cays in 1939.

7 0
3 years ago
Right now, we are threatened by global climate change. This is due to changes in _____ conditions, an increase in _____.
Ludmilka [50]
<span>onosphere rise in sea level</span>
3 0
3 years ago
Read 2 more answers
What part of the cell cycle is represented by the picture labeled as steps 2-4?
Umnica [9.8K]

Answer:

Does your bio textbook show you?

4 0
2 years ago
Which is a result of seasonal change (meaning a change that happens over and over at a certain time of year)? A. Bears hibernati
Daniel [21]

Answer:

A.

Explanation:

All other options are simply situational, while cold periods are usually seasonal.

5 0
3 years ago
Other questions:
  • What types of organisms produce food from inorganic molecules(very few) or sunlight (lots)?
    13·1 answer
  • Which one of the following statements is accurate?
    14·2 answers
  • Gametes are formed by<br> A. Parthenogenesis <br> B. Mitosis <br> C. Fertilization <br> D. Meiosis
    12·1 answer
  • For each of the following scenarios, state the type of inheritance (20 points) and explain how you are able to discern this info
    9·1 answer
  • Renewable resources can be used without worry about consequences to the environment.
    15·1 answer
  • What discoveries has space technology helped paleontologists with?
    13·2 answers
  • On a pH scale water is located at 7, hydrochloric acid (HCl) is located below 7 and sodium hydroxide (NaOH) is located above 7.
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • If a strand of DNA has the following base sequence, what would the base sequence of the mRNA that is transcribed be?
    14·1 answer
  • What is the most interesting thing about the evolution of plants? Please explain your answer.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!