1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
2 years ago
15

What is a meal service​

Biology
2 answers:
madreJ [45]2 years ago
8 0
Meal service, or dining style, simply refers to the way a meal is served to the diner and who is serving it. All required meal components, except the dessert, are placed on the table at the same time for casual dining. Platters and bowls of food are passed around the table… to the right, or counter-clockwise.
elena55 [62]2 years ago
3 0
Where you gets lots and lots of nmfood
You might be interested in
How do the ranges for the marine bird and sea turtle species species compared
Virty [35]

Answer: Varies

Explanation:

It's based on there being many different types.

7 0
2 years ago
Read 2 more answers
PLEASE HURRY!!!!!!!!!!!!!!!!!
Daniel [21]

Answer:

I think its D

Explanation:

5 0
2 years ago
Read 2 more answers
The movement of materials across the cell is known as
Sauron [17]
I'm sure the answer is diffusion
8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How do tough waxy cuticles on leaves prevent infection?
musickatia [10]
Because it's partially permeable membrane so it won't let anything get inside the leaf so by this cuticle the leaf is protected not to let any foreign substances in and preventing loss of water
4 0
3 years ago
Read 2 more answers
Other questions:
  • A sustainable business practice called encourages customers to return products to the companies that sold them
    12·1 answer
  • A simple diagram of a DNA molecule is shown below. Which of the following is represented by X?
    8·2 answers
  • The metric system is a decimalized system of measurement used exclusively in the united states.
    11·2 answers
  • 22 points!
    7·1 answer
  • What are the advantages of having a double helix contain 2 dna strands
    9·1 answer
  • Watch the seven minute video on the "Mystery of the Buffalo boom" on you tube. Write a reflection on how scientists used their r
    15·1 answer
  • Reasoning: Write a three sentence statement that connects your evidence to your claim
    13·1 answer
  • What effect do enzymes have on chemical reactions?
    6·1 answer
  • Question 4
    12·1 answer
  • Where are poisonous plant cells most likely to store poison?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!