1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
2 years ago
10

A researcher is viewing a cell that has cell walls. Which question would BEST help the researcher to narrow down the taxonomic g

roup to which the cell belongs ?
Biology
1 answer:
suter [353]2 years ago
3 0

Answer:

Does it have a nucleus?

Explanation:

Bacteria and Archaea have cell walls but no nuclei

Plant cells (Eukarya) have cell walls and a nucleus.

But remember not all eukaryotes have cell walls

You might be interested in
What is the width of small intestine
agasfer [191]

Answer:

The small intestine is about 20 feet (6 meters) long and folds many times to fit in the abdomen. Although it is longer than the large intestine, it is called the small intestine because it is smaller in width.

I hope this will help you

5 0
2 years ago
Read 2 more answers
Help ASAP!! (2 questions)
Aleksandr-060686 [28]

Animals get carbon by eating plants or by eating other animals.

so the correct answer would be C

The lion eats an herbivore that ate the grass

Plants use carbon dioxide for photosynthesis. By doing so, they remove inorganic carbon from the atmosphere and incorporate it into the plants’ tissues in the form of organic carbon (sugar and starch).

Carbon is returned to an inorganic state in a number of ways. As an animal breathes (respires), it exhales carbon dioxide, returning it back to the atmosphere. When an animal or plant dies, it is broken down by bacteria and fungi and again the carbon is released (this process is called decomposition).

Sometimes, instead of completely decomposing, a plant or animal may be fossilised, leading to its carbon being stored in a rock. After millions of years and under the right conditions, these fossils may turn into fossil fuels (oil, coal and natural gas).

hope this helps!!

5 0
3 years ago
A teacher cut an apple into three wedges of the same size.
dexar [7]

I am not entirely sure what you mean by "responding variable" but I'm going to guess  it was the vinegar since it has been used as a  perservative for years.

Hope that helps in some way.

7 0
3 years ago
Which staternent is one of the three parts of cell theory
DerKrebs [107]

Answer:

The Cell Theory:

Explanation:

1.cells are the basic human of structure and function of all living things

2. cells are the smallest part of a living that that is alive a keeps the organism alive  

3. all cells from from other cells

4. cells are damaged or destroyed, so they need replacing

hope this helps

5 0
2 years ago
Points and brainlyist if you can name 10 facts about how women suffer a lot more than males.
Burka [1]

Answer:

periods

nail

having kids

brushing long hair

shaving

waxing

taking care of kids

work while pregnate

morning sickness

doing girls hair

cramps

cleaning

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which theory of water transport in xylem can also be used to explain the primary movement of water in nonvascular plants such as
    5·1 answer
  • A nurse is assessing a newborn in the well baby nursery. what type of respirations does the nurse expect to identify in a health
    12·2 answers
  • A student pushes a box with a total mass of 50kg what is the net force on the box if it accelerates 1.5 m/s2
    14·2 answers
  • Place the
    12·1 answer
  • Phytoplankton use sunlight to gain energy through photosynthesis. As a result of the Law of Conservation of Energy, phytoplankto
    7·1 answer
  • What is the difference between control group and controlled variables of an experiment
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If you think about fat as old stuff,what new stuff can be made from it
    15·2 answers
  • This question refers to the abo blood type locus. remember that the a and b alleles are codominant to each other and both are do
    7·1 answer
  • An engine can exert a force of 1 000 newtons. how fast can this engine accelerate
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!