Answer:
a. the RNA polymerase undergoes abortive initiation prior to promoter clearance
Explanation:
In eukaryotes the 3' end of the mRNA is polyadenylated to protect the mRNA from degradation.
In eukaryotes, a modified guanine cap is added to the 5' end of the mRNAd to protects the transcript from being broken down.
Most bacterial RNA transcripts do not undergo splicing.
The nucleosome is the basic unit of chromatin repeat in eukaryotes.
• Genes can contain more than one polyadenylation site, which alters the 3' of the mRNA transcript and the inclusion/exclusion of exons.
• mRNA transcripts from the same gene can be differentially spliced to include/exclude exons.
Answer:
Spindle fibers form a protein structure that divides the genetic material in a cell. The spindle is necessary to equally divide the chromosomes in a parental cell into two daughter cells during both types of nuclear division: mitosis and meiosis. During mitosis, the spindle fibers are called the mitotic spindle.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
<span>Sweep prey organisms, along with some water, through the oral groove, and into the mouth opening. </span>
