1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
3 years ago
8

In the presence of oxygen, _____ molecules of ATP can be formed during cellular respiration.

Biology
1 answer:
vredina [299]3 years ago
4 0
The answer is A. 36 to 38 molecules
You might be interested in
Which structure is the initial entry way for air to enter the respiratory system?
Alexxx [7]
It is the nose I think.
6 0
3 years ago
Action potentials in the heart spread from cell to cell through
Leni [432]

Answer:

Gap junctions within the intercalated disks

Explanation: Gap junctions within the intercalated disks allow impulses to be propagated from one cardiac muscle cell to another. It allows sodium, potassium, and calcium ions to flow between adjacent cells, propagating the action potential, and ensuring coordinated contractions.

8 0
3 years ago
What bias conditions must be present for the normal operation of a transistor amplifier?
Maksim231197 [3]
The bias conditions that must be present for the normal operation of a transistor amplifier will be those in which the emitter-base junction is forward biased, and the collector-base junction will be reverse biased.
<span />
7 0
3 years ago
During osmosis, water molecules move across the cell membrane.
Ivanshal [37]
True tehehehehehehhee
5 0
3 years ago
Which of the following is not a property of water?
Eduardwww [97]
The answer is c Ability to contract upon freezing
5 0
3 years ago
Read 2 more answers
Other questions:
  • What molecule would be the most affected by limited nitrogen?
    10·2 answers
  • Many bacteria are able to pass small pieces of the hereditary information on their DNA from one bacterial cell to another. This
    13·2 answers
  • Which one of the following comes from the latin word for “honey,” which refers to the spilling of sugar into the urine by diabet
    7·2 answers
  • What types of matter are made of atoms?
    5·1 answer
  • Sex determination is an example of environmental factors influencing the phenotype.
    9·2 answers
  • Pls Help Marking brainliest if it's correct pls explain​
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Conclusion in microscope
    10·1 answer
  • Homologous chromosomes may exchange segments; this is called crossing over. Crossing over increases genetic variability. When do
    9·1 answer
  • One afternoon, there was heavy rainfall, and many large puddles formed on Rachel's street. A few days later, Rachel noticed the
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!