There are four main organelles:
Nucleus
Ribosome
Rough Endoplasmic Reticulum
Golgi Apparatus
However, the ribosome is the most responsible for making protein, even though the other 3 are also important. It isn't a cell organelle but a cell structure that produces proteins.
Answer:
Mutations are permanent changes in the DNA due to changes in nucleotide sequences. Mutations that cause addition of extra nucleotides in a nucleotide sequences are known as frameshift mutations
In the inner mitochondrial membrane
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
