Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
<h2>Inside the cones of pine tree</h2>
Explanation:
- The life cycle of a pine tree starts in the strobulus, the sexual conceptive structure in a completely adult pine tree. Strobulii is otherwise called the "pine cones." Male strobulii are in the lower some portion of the tree, while the female structures are in the upper part. The strobulli are viewed as unisexual structures since they have either male or female sexual organs. The male strobulli in a pine tree contains microsporocytes, grains that in the end form into dust. In the spring months, male strobulli discharge dust into the air, which is focused on the pine tree's female strobulli.
- A pine seed finds the right micro-climate, it will in the eventually sprout and a pine seedling begin to develop. Be that as it may, pine seeds are typically discharged in a torpid state, which is regularly broken by chilly stratification. Therefore, a pine seed won't grow until the accompanying spring when warm climate and some spring dampness are available. Since pine seeds are created in rich numbers, and just a small rate should be successful in building up new seedlings.
The answer to this question is B.
Answer:
Cells provide six main functions. They provide structure and support, facilitate growth through mitosis, allow passive and active transport, produce energy, create metabolic reactions and aid in reproduction.
Explanation:
Answer:
c
Explanation:
ribosomes are used to synthesize proteins in cell. When it had been destroyed, the cell won't get proteins
