1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
3 years ago
11

Anyone know this?? pls help me

Biology
1 answer:
valentinak56 [21]3 years ago
6 0

Answer: 4

Explanation: When an object is red-shifted, it means the object is rapidly moving away from you. Distant galaxies are red-shifted because they are rapidly expanding outwards away from you.

You might be interested in
Being able to understand and follow rules is an example of _<br> __skills.
ivanzaharov [21]

Answer:

how many letters are there before skills?

Explanation:

If there is two spaces then i have the wrong answer

5 0
3 years ago
Some areas of a forest contain rich soil, while in other areas the soil is poor. Plants of a certain species grow taller in the
uranmaximum [27]
A The observed differences in plants height are due to genetics.
6 0
2 years ago
Read 2 more answers
State zeroth law of thermodynamics​
alexandr1967 [171]

Answer:

This is the last law of thermodynamics that we know of so far. The zeroth law of thermodynamics states that if two bodies are each in thermal equilibrium with some third body, then they are also in equilibrium with each other.

Explanation:

8 0
3 years ago
What is another word for heterozygous?
Sonja [21]

Answer:

Hybrid

Explanation:

7 0
3 years ago
Making products from recycled materials __________.
Travka [436]
The answer is A. Uses too much energy.
4 0
3 years ago
Other questions:
  • When an E. coli cell is infected by multiple phages, what route of infection (lytic or lysogenic) will the phages take? Why?
    6·1 answer
  • Surface currents are generated by _____. temperature density salinity wind
    6·2 answers
  • What happens in exponential growth as the population gets larger?
    11·1 answer
  • An organism reacts to changes in its environment. this is called
    13·1 answer
  • Why is a "shell of hydration" important to life?
    13·1 answer
  • What happens in sexual reproduction?
    12·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Where do these reactants enter the leaf? (be very specific)
    15·1 answer
  • What<br> was photograph 51 ?
    8·1 answer
  • Most places on Earth experience one low tide and one high tide each day.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!