Answer:
Answer to Two yeast cells were placed into a special container to which food was continually ... All Other Factors Were Set For Optimal Yeast Growth (for Example, ... The Population Was Sampled Every Hour For 21 Hours And The Results Of The ... to which food was continually added, to keep it at a constant concentration.
Explanation:
Answer to Two yeast cells were placed into a special container to which food was continually ... All Other Factors Were Set For Optimal Yeast Growth (for Example, ... The Population Was Sampled Every Hour For 21 Hours And The Results Of The ... to which food was continually added, to keep it at a constant concentration.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer is that the nurse should identify is a UTI urinary track infection
Answer:
Patriotism or national pride is the feeling of love, devotion, and sense of attachment to a homeland or the country and alliance with other citizens who share the same sentiment to create a feeling of oneness among the people. This attachment can be a combination of many different feelings, language relating to one's own homeland, including ethnic, cultural, political or historical aspects.
