<h2>Answer:</h2>
a. one allele from each parent
<h2>Explanation:</h2>
An allele in biological sciences is one of the possible forms of a gene that it can inherit. Most genes have two alleles, a dominant allele and a recessive allele. When Gregor Mendel crossed a tall plant with a short plant, the F1 plants inherited an allele for tallness from the tall parent and an allele for shortness from the short parent.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
A food web is the natural interconnection of food chains and a graphical representation of what-eats-what in an ecological community. Another name for food web is consumer-resource system.
Answer:
The orchids derive nutrients from the association at very young stages of its life cycle while the fungi obtain water and organic matter
Explanation:
As stated in this question, fungi species belonging to the phylum Basidiomycota form mycorrhizal associations with a flowering plant called orchids. This relationship is a mutualistic one because both participants benefit from the relationship.
In this association, the young orchid plant relies on the mycorrhizal fungi's metabolism to get nutrients needed for its development in form of carbohydrates while the fungi in return gets water (from the roots of the plant) and organic matter.
