1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
neonofarm [45]
3 years ago
7

Which part of a seed acts as the food source for the seed as it grows underground?

Biology
1 answer:
liubo4ka [24]3 years ago
5 0
The answer is a cotyledon
You might be interested in
In your own words, explain the difference between physical properties and chemical properties.
Alex Ar [27]

Answer:

Chemical properties are tested on not because of their color or their appearance but how they will react to certain tests. Such as; is it flammable? Could it be toxic? Physical properties are tested on and observed because of the texture, the color, smell and etc.

Hope this helps!

P.S: I love your profile picture!

5 0
3 years ago
Read 2 more answers
Which of the following could be a sequence in the carbon cycle?
andrew11 [14]

If you want faster replys or even replys at all, you need to give all the info.

7 0
3 years ago
A ___________ chain is a sequence of amino acids that is the foundation for the basic structure of a protein.
navik [9.2K]
A Polypeptide chain is a sequence of amino acids that is the foundation for the basic structure of a protein
6 0
3 years ago
Read 2 more answers
Help in this biology work please
noname [10]

Answer:hi

Explanation:

5 0
3 years ago
Reaction of photosynthesis changes the energy of the Sun into chemical energy.
Strike441 [17]

Answer:

light

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to the amount of light as you go deeper in an aquatic system
    14·1 answer
  • What best describes the flow of genetic formation
    8·1 answer
  • Enzymes are affected by both pH and A. temperature. B. catalysts. C. nucleic acids. D. bonding.
    12·1 answer
  • What is recombination and how does it work? is it the same thing as crossing-over? if an organism practiced self-fertilization,
    7·1 answer
  • What role does transpiration play in the water cycle
    8·2 answers
  • Give two similarities and two differences between<br> gymnosperms and angiosperms.
    11·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What amino chain is coded for by the mRNA sequence 5'AUGUGGAUUUU3'?​
    8·1 answer
  • Calculate the genotypic and phenotypic ratios for the following crosses in peas for height, determined by the T gene. (T is Tall
    10·1 answer
  • What is/are the function(s) of the cell cycle? dna replication development of positive mutations prevention of cancer growth, re
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!