1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
6

PLEASE HELP WILL MARK BRAINLIST The group of animals (a pod of orcas) shown below is an example of What level of organization? C

ommunity Population Ecosystems Individual​

Biology
1 answer:
Mars2501 [29]3 years ago
7 0

Answer:

The answer is likely population or community

Explanation:

the reason that it is not an ecosystem is because an ecosystem is more than just than group of animals itself it also includes the water and things growing underneath it. The reason that it is not an individual is because there is more than one there (a group).

You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
In the light-independent reactions of photosynthesis, CO2 is added to a five-carbon molecule known as
navik [9.2K]
It’s known as D.RuBP.
3 0
3 years ago
Please help i need to finish this today before bed and i need a passing grade to start my next assignment.
AveGali [126]
An answer might be - <span>Any of a group of complex organic macromolecules that contain carbon, hydrogen, oxygen, nitrogen, and usually sulfur and are composed of one or more chains of amino acids. Proteins are fundamental components of all living cells and include many substances, such as enzymes, hormones, and antibodies, that are necessary for the proper functioning of an organism. They are essential in the diet of animals for the growth and repair of tissue and can be obtained from foods such as meat, fish, eggs, milk, and legumes.


</span>
4 0
3 years ago
30 POINTS ANSWER QUICKLY!
ICE Princess25 [194]
They both want to eat meat and fish so they try to avoid each other
4 0
3 years ago
The nurse is providing instruction to the newly delivered client regarding postbirth uterine and vaginal discharge, called lochi
user100 [1]

<u>Answer:</u>

The statement 'it should smell like normal menstrual flow unless an infection is present' reflects the ability of the kidneys to recover from acute renal failure.

Option: (B)

<u>Explanation:</u>

  • Lochia is the uterine and vaginal discharge occurring at post birth stage in a woman.
  • Certainly, the odour should be same as the Normal Menstrual Fluids.
  • Any difference in the smell or color (like greenish color) of Lochia indicates the presence of infectious organisms such as Chlamydia or Saprophytic which are potential organism for causing infection in women.
3 0
3 years ago
Other questions:
  • What geometric arrangements did Ptolemy use to explain retrograde motion
    15·1 answer
  • Which type of condition is acquired in a hospital or clinic setting?
    10·1 answer
  • Despite considerable concern about the high rate of _________ use among pregnant women, studies have failed to find a homogeneou
    14·1 answer
  • What is the energy in an atoms nucleus?
    8·1 answer
  • Describe some of the main geologic events occurring during the permian era
    12·1 answer
  • What is evolution? what are the pieces of evidence scientists use to study evolution?
    7·1 answer
  • Which organelle is responsible for poviding a barrier?
    7·1 answer
  • How could you adapt the
    12·1 answer
  • What is the function of the cell membrane?
    12·1 answer
  • What does the speed of an object tell you about that object's motion?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!