1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
2 years ago
10

First answer gets brainliest so hurry up y’all

Biology
1 answer:
vova2212 [387]2 years ago
8 0

Answer: 500 g

Explanation: if a burning candle is put into a jar, with the covering, the candle will take a faster time to burn out. The heat inside the jar will not be able to escape the jar.

But if it doesn't have a lid, the candle to liquefy slower due to the candle not having a lid.

You might be interested in
The caregiver of a 4-year-old girl who lives in a heavily wooded area calls the clinic nurse to report that the child has a swol
marta [7]
Taking the child to a doctor for treatment for the tick bite so the child doesnt get sick.
7 0
3 years ago
Which is not a compound?<br> 8H2<br> H2O<br> 6CaO<br> 5HCl
poizon [28]
8H2. The actual equation doesn't make sense for 8H2. This is because in compounds it always says the number of atoms after the element symbol, but in this case, there is an 8 before it. This means that it isn't a compound. 
3 0
3 years ago
Read 2 more answers
Discuss the relationship between mitosis and cytokinesis. what would be the result if one happened without the other ?
DENIUS [597]
If mitosis occurred without cytokinesis, the cell would contain two nuclei and twice the DNA. If cytokinesis occurred without mitosis , one of the new cells would lack DNA and a nucleus altogether. The cell cycle is regulated by signals both inside and outside of the cell.
4 0
3 years ago
Which of the following pathway would a protein destined for the interior of the nucleus follow
BigorU [14]

Answer: The protein is translated on free ribosomes and then passes through the pore complex to enter the nucleus.

Explanation:

4 0
3 years ago
Compared with ect, rtms is ________ likely to produce seizures and ________ likely to produce memory loss.
olga nikolaevna [1]
<span>The answer would be: less; less

Repetitive Transcranial Magnetic Stimulation(</span>rTMS) and Electro Convulsion Therapy(ECT) are a treatment option for a patient with major depressions. Both of them is dangerous because it involves a stimulation of the brain and has a chance to do permanent damage afterward. rTMS is a newer method that has lower chance of side effect.
6 0
3 years ago
Other questions:
  • State one rease why an individual's pulse rate increased during exercise
    12·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Of the more than 35 animal phyla, the ____________ are considered the most successful of all animal groups.
    7·1 answer
  • PLZ HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!! 20 pts!!!!!!!!!!!!!!!!!!
    10·2 answers
  • The stem of a plant grows_________from the pith. outwards or inwards
    13·1 answer
  • The star turns matter into energy is the process of______
    14·1 answer
  • (ASAP) explain why MRSA strains are difficult to treat. 3 marks
    10·2 answers
  • If a 160lb individual has 28% body fat how much of their body weight is fat in lbs.?
    15·1 answer
  • C. Directions: Answers must be in essay form. Outline form is not acceptable. Labelled diagrams may be used to supplement discus
    15·1 answer
  • The passage of IgG antibodies from mother to fetus illustrates: A. natural immunity. B. cell-mediated immunity. C. passive immun
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!