1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
exis [7]
3 years ago
14

GIVING BRAINLIEST

Biology
2 answers:
AfilCa [17]3 years ago
5 0

Answer:

D

Explanation:

A It allows the lodgepole pine tree to make more seeds in cones that are hard to open. IS WRONG B) It creates more wildfires for the lodgepole pine tree to reproduce. IS WRONG C) It makes the seeds travel and grow in areas where there are no wildfires. DEFINITLY NOT so that leaves it with D  It helps the lodgepole pine tree to protect the seeds and to reproduce.

enyata [817]3 years ago
4 0

Answer:

D

Explanation:

A layer of resin and woody tissue sticks the cones' scales together. The seeds are locked in tight, and the cones can't open unless they're exposed to VERY high temperatures like the type of temperatures that fire provides. This shows they survive through exposing the seeds after forest fires.

You might be interested in
Which pair of structures would provide a positive identification of a plant cell under a microscope?
noname [10]

Answer:

b

Explanation:

b

6 0
3 years ago
Read 2 more answers
What is happening when an opaque object appears solid black?
san4es73 [151]
B all light is being absorbed
8 0
3 years ago
What is the name of the enzyme used to make rna nucleotides
Likurg_2 [28]
<h2>RNA Polymerase</h2>

Explanation:

  • RNA polymerase, a chemical in the cell, is  answerable for making mRNA from the  right quality. RNA polymerase is like  DNA polymerase, yet it makes a RNA strand  as opposed to a DNA strand. The promoter region of DNA Helix is attached by  RNA polymerase.
  • It pulls in nucleotides that supplement those  on the DNA strand containing the gene of interest. RNA polymerase duplicates one strand of  DNA to make a stretching bit of singlestranded  mRNA. RNA polymerase makes the  mRNA strand in what is known as the 5' to 3'  course.
8 0
3 years ago
Which experment would most likely contain bias?
padilas [110]

Bias is defined as any tendency which prevents unprejudiced consideration of a question. In research, bias occurs when “systematic error [is] introduced into sampling or testing by selecting or encouraging one outcome or answer over others”.

5 0
3 years ago
Large molecules such as glucose move across cell membranes through special protein channels during?
Pavel [41]

Answer:

Glucose is a six-carbon sugar that is directly metabolized by cells to provide energy. ... A glucose molecule is too large to pass through a cell membrane via simple diffusion. Instead, cells assist glucose diffusion through facilitated diffusion and two types of active transport.

Explanation:

4 0
3 years ago
Other questions:
  • How big are paramecium?
    6·2 answers
  • Which type of gene is most likely to be widely expressed in the body of someone who has a superficial scrape?
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Explain how an immune response starts after a macrophage attacks a pathogen.
    7·1 answer
  • During the last century, both global temperatures and men’s average height have increased. Do these correlated trends mean that
    5·1 answer
  • Question 7
    15·1 answer
  • 2 points<br>Identify the device shown<br>below and state its purpose<br>Your answer​
    9·1 answer
  • (WILL GIVE BRAINLY)
    13·1 answer
  • Answer 16-20 please, please do not comment nonsense if not you will be reported. The first accurate and correct answer gets brai
    15·1 answer
  • Which part of the brain receives messages from the hair-like receptors
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!